Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1116585583:

Variant ID: vg1116585583 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 16585583
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, A: 0.10, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TTTATTTTATTTTCCTCGAAATCGATTATCGCTGGCGGCTGTCATAGCACAACCGCCTGCAAAATTTGATTATTGCTGGCGGTCCTCGTAAGGCTGCAGC[C/A]
AGCGAAGATATTTTTCGCTGGCGGCTGTCTTAAGCAGGACGCCAATGAAAATACATTTTTGCTAGCGACTGCCTTAAGACAGCCGCTAGCGAAGATATAT

Reverse complement sequence

ATATATCTTCGCTAGCGGCTGTCTTAAGGCAGTCGCTAGCAAAAATGTATTTTCATTGGCGTCCTGCTTAAGACAGCCGCCAGCGAAAAATATCTTCGCT[G/T]
GCTGCAGCCTTACGAGGACCGCCAGCAATAATCAAATTTTGCAGGCGGTTGTGCTATGACAGCCGCCAGCGATAATCGATTTCGAGGAAAATAAAATAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.20%	10.50%	3.85%	13.46%	NA
All Indica	2759	78.50%	13.60%	3.26%	4.68%	NA
All Japonica	1512	56.70%	4.00%	5.89%	33.33%	NA
Aus	269	81.00%	19.00%	0.00%	0.00%	NA
Indica I	595	91.60%	5.40%	1.85%	1.18%	NA
Indica II	465	92.00%	4.50%	0.86%	2.58%	NA
Indica III	913	61.40%	24.00%	6.35%	8.21%	NA
Indica Intermediate	786	80.30%	13.10%	2.16%	4.45%	NA
Temperate Japonica	767	85.10%	1.20%	2.35%	11.34%	NA
Tropical Japonica	504	25.00%	9.10%	9.13%	56.75%	NA
Japonica Intermediate	241	32.80%	2.50%	10.37%	54.36%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	12.20%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1116585583	C -> A	LOC_Os11g28690.1	upstream_gene_variant ; 3821.0bp to feature; MODIFIER	silent_mutation	Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg1116585583	C -> A	LOC_Os11g28680.1	downstream_gene_variant ; 3143.0bp to feature; MODIFIER	silent_mutation	Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg1116585583	C -> A	LOC_Os11g28680-LOC_Os11g28690	intergenic_region ; MODIFIER	silent_mutation	Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg1116585583	C -> DEL	N	N	silent_mutation	Average:59.454; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1116585583	NA	3.19E-06	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583	NA	8.82E-06	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583	NA	2.42E-06	mr1479	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583	NA	5.33E-06	mr1502	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583	NA	1.29E-06	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583	6.37E-09	1.01E-08	mr1919	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583	NA	1.71E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1116585583	NA	8.77E-06	mr1975	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251