| Variant ID: vg1115817874 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 15817874 |
| Reference Allele: A | Alternative Allele: G,T |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 89. )
TTAAAAAAATATTCCCAGTTATGATTTCTAAAAGAAATTTTATTTCCCACATTAAAATCACTTGATAAATTGATGGAGGCGGATGCGGACGATTTACGGC[A/G,T]
CAAATCAACAAAGATGGACGAACTAGGCTAGAACTAGGTAAAAAGTAGATGCAATATTGAAAAAAAGCGATTCAATTGGTTAAATTGGATTGAGATTAGA
TCTAATCTCAATCCAATTTAACCAATTGAATCGCTTTTTTTCAATATTGCATCTACTTTTTACCTAGTTCTAGCCTAGTTCGTCCATCTTTGTTGATTTG[T/C,A]
GCCGTAAATCGTCCGCATCCGCCTCCATCAATTTATCAAGTGATTTTAATGTGGGAAATAAAATTTCTTTTAGAAATCATAACTGGGAATATTTTTTTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.00% | 37.70% | 0.23% | 0.06% | NA |
| All Indica | 2759 | 59.90% | 39.90% | 0.14% | 0.11% | NA |
| All Japonica | 1512 | 64.40% | 35.30% | 0.40% | 0.00% | NA |
| Aus | 269 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 42.50% | 57.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 64.30% | 35.30% | 0.22% | 0.22% | NA |
| Indica III | 913 | 64.80% | 35.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 64.60% | 34.90% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 91.90% | 7.60% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 23.00% | 76.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 63.10% | 36.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 30.20% | 68.80% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 38.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1115817874 | A -> T | LOC_Os11g27480.1 | downstream_gene_variant ; 3913.0bp to feature; MODIFIER | N | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg1115817874 | A -> T | LOC_Os11g27490.1 | downstream_gene_variant ; 871.0bp to feature; MODIFIER | N | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg1115817874 | A -> T | LOC_Os11g27500.1 | downstream_gene_variant ; 4820.0bp to feature; MODIFIER | N | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg1115817874 | A -> T | LOC_Os11g27490-LOC_Os11g27500 | intergenic_region ; MODIFIER | N | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg1115817874 | A -> DEL | N | N | silent_mutation | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg1115817874 | A -> G | LOC_Os11g27480.1 | downstream_gene_variant ; 3913.0bp to feature; MODIFIER | silent_mutation | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg1115817874 | A -> G | LOC_Os11g27490.1 | downstream_gene_variant ; 871.0bp to feature; MODIFIER | silent_mutation | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg1115817874 | A -> G | LOC_Os11g27500.1 | downstream_gene_variant ; 4820.0bp to feature; MODIFIER | silent_mutation | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| vg1115817874 | A -> G | LOC_Os11g27490-LOC_Os11g27500 | intergenic_region ; MODIFIER | silent_mutation | Average:54.907; most accessible tissue: Minghui63 flag leaf, score: 76.091 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1115817874 | NA | 1.16E-06 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 4.34E-06 | mr1359 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 3.63E-10 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 3.26E-07 | mr1403 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 8.18E-06 | mr1415 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 6.85E-11 | mr1539 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 8.18E-06 | mr1567 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 1.14E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 8.06E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1115817874 | NA | 5.21E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |