Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1115560507:

Variant ID: vg1115560507 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 15560507
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAACTAGCACTCTAGCAGTCCTAATTCCCGGCGGAAGGAATATTGGCCAGTCCAAAAAAACCCTAAGTATGTTGCTACGTACTTGAGCTACTATATAGTT[T/C]
CACAAATGGATTTTATAGGAATTTCATATGGATTATATTAGTACTTGAGCTACTATATAGTTCCACAAATGGATTTTAAAGGAATTTCATATGGATTATA

Reverse complement sequence

TATAATCCATATGAAATTCCTTTAAAATCCATTTGTGGAACTATATAGTAGCTCAAGTACTAATATAATCCATATGAAATTCCTATAAAATCCATTTGTG[A/G]
AACTATATAGTAGCTCAAGTACGTAGCAACATACTTAGGGTTTTTTTGGACTGGCCAATATTCCTTCCGCCGGGAATTAGGACTGCTAGAGTGCTAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.40%	9.60%	4.72%	1.21%	NA
All Indica	2759	76.80%	15.00%	6.23%	1.99%	NA
All Japonica	1512	98.00%	1.10%	0.79%	0.07%	NA
Aus	269	82.50%	4.50%	13.01%	0.00%	NA
Indica I	595	72.60%	18.30%	7.06%	2.02%	NA
Indica II	465	77.40%	15.90%	4.95%	1.72%	NA
Indica III	913	83.00%	9.70%	5.48%	1.75%	NA
Indica Intermediate	786	72.40%	17.90%	7.25%	2.42%	NA
Temperate Japonica	767	97.40%	1.60%	1.04%	0.00%	NA
Tropical Japonica	504	98.80%	0.40%	0.60%	0.20%	NA
Japonica Intermediate	241	98.30%	1.20%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	78.90%	15.60%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1115560507	T -> DEL	N	N	silent_mutation	Average:48.996; most accessible tissue: Callus, score: 86.593	N	N	N	N
vg1115560507	T -> C	LOC_Os11g27020.1	upstream_gene_variant ; 336.0bp to feature; MODIFIER	silent_mutation	Average:48.996; most accessible tissue: Callus, score: 86.593	N	N	N	N
vg1115560507	T -> C	LOC_Os11g27030.1	upstream_gene_variant ; 4034.0bp to feature; MODIFIER	silent_mutation	Average:48.996; most accessible tissue: Callus, score: 86.593	N	N	N	N
vg1115560507	T -> C	LOC_Os11g27010.1	downstream_gene_variant ; 2987.0bp to feature; MODIFIER	silent_mutation	Average:48.996; most accessible tissue: Callus, score: 86.593	N	N	N	N
vg1115560507	T -> C	LOC_Os11g27010-LOC_Os11g27020	intergenic_region ; MODIFIER	silent_mutation	Average:48.996; most accessible tissue: Callus, score: 86.593	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1115560507	NA	3.05E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	6.04E-74	mr1135	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	2.05E-21	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	7.31E-30	mr1333	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	2.31E-24	mr1383	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	6.60E-11	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	1.26E-35	mr1682	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	1.50E-08	8.40E-107	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	3.12E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	4.59E-20	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	3.78E-20	mr1838	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	1.49E-23	mr1917	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	2.12E-16	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	2.59E-06	1.63E-06	mr1124_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	5.89E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	NA	1.62E-22	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1115560507	2.70E-07	1.21E-149	mr1758_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251