Variant ID: vg1115387288 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 15387288 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 286. )
AATGGTGGATGTGAAGTTATACATGTTAGTAAAAATATCACTGAACGATGAATGTGAGAGTGATTCATGTTAGTAATAAAATTACTAAATGATGTTTGCG[G/A]
GAGTTCTACATTTGTTTCATGCTTCAGAAATAACAAAAGGAATAACATGTAAAAATATAACTCAAATAGCAATTTAAGAAAGTTGGTGTCAATTGATTTC
GAAATCAATTGACACCAACTTTCTTAAATTGCTATTTGAGTTATATTTTTACATGTTATTCCTTTTGTTATTTCTGAAGCATGAAACAAATGTAGAACTC[C/T]
CGCAAACATCATTTAGTAATTTTATTACTAACATGAATCACTCTCACATTCATCGTTCAGTGATATTTTTACTAACATGTATAACTTCACATCCACCATT
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
All Indica | 2759 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 94.90% | 5.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1115387288 | G -> A | LOC_Os11g26810-LOC_Os11g26830 | intergenic_region ; MODIFIER | silent_mutation | Average:37.302; most accessible tissue: Callus, score: 71.164 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1115387288 | 5.65E-06 | 9.55E-06 | mr1154 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115387288 | 2.46E-10 | 5.98E-11 | mr1097_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115387288 | NA | 7.88E-06 | mr1102_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115387288 | 8.82E-11 | 5.84E-10 | mr1154_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1115387288 | NA | 1.17E-06 | mr1223_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |