RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1114869858:

Variant ID: vg1114869858 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14869858
Reference Allele: T	Alternative Allele: G,C
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

AGTCGTTGCTCCACAGAAAACTCTACCGACAAAGAAACCAGCCGTACCAACGCCACTGACCTTCAAGACAATGGCCAGCAAGACTCTTCGCGAGTTCGCT[T/G,C]
TTCCCTCTGCTGACAATGTGGCCGTCGAGCCACAAGTCAACATAGGAGATGTGGATTTCGATTTGAAGTCCAGCCTCATCATGATGGCGCAGGCTAGCCT

Reverse complement sequence

AGGCTAGCCTGCGCCATCATGATGAGGCTGGACTTCAAATCGAAATCCACATCTCCTATGTTGACTTGTGGCTCGACGGCCACATTGTCAGCAGAGGGAA[A/C,G]
AGCGAACTCGCGAAGAGTCTTGCTGGCCATTGTCTTGAAGGTCAGTGGCGTTGGTACGGCTGGTTTCTTTGTCGGTAGAGTTTTCTGTGGAGCAACGACT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	28.00%	8.50%	37.71%	25.56%	C: 0.23%
All Indica	2759	2.90%	1.80%	55.56%	39.36%	C: 0.40%
All Japonica	1512	74.50%	22.40%	1.72%	1.32%	NA
Aus	269	0.70%	0.40%	69.14%	29.74%	NA
Indica I	595	4.00%	1.80%	37.48%	56.47%	C: 0.17%
Indica II	465	2.40%	0.20%	52.04%	45.38%	NA
Indica III	913	1.90%	0.90%	72.51%	23.99%	C: 0.77%
Indica Intermediate	786	3.40%	3.80%	51.65%	40.71%	C: 0.38%
Temperate Japonica	767	60.50%	36.10%	1.43%	1.96%	NA
Tropical Japonica	504	95.80%	0.80%	2.58%	0.79%	NA
Japonica Intermediate	241	74.70%	24.10%	0.83%	0.41%	NA
VI/Aromatic	96	84.40%	6.20%	6.25%	3.12%	NA
Intermediate	90	40.00%	4.40%	34.44%	21.11%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114869858	T -> DEL	LOC_Os11g26000.1	N	frameshift_variant	Average:13.618; most accessible tissue: Callus, score: 19.394	N	N	N	N
vg1114869858	T -> G	LOC_Os11g26000.1	missense_variant ; p.Phe11Val; MODERATE	nonsynonymous_codon ; F11A	Average:13.618; most accessible tissue: Callus, score: 19.394	probably damaging	-2.378	TOLERATED	1.00
vg1114869858	T -> C	LOC_Os11g26000.1	missense_variant ; p.Phe11Leu; MODERATE	nonsynonymous_codon ; F11L	Average:13.618; most accessible tissue: Callus, score: 19.394	benign	-0.934	DELETERIOUS	0.00

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114869858	NA	3.69E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869858	2.08E-06	1.14E-06	mr1230	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869858	NA	4.58E-08	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869858	NA	4.00E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869858	7.76E-06	1.24E-07	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869858	9.77E-06	9.76E-06	mr1424	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114869858	NA	5.99E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 7 of 7 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg1114869858:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact