| Variant ID: vg1114869807 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14869807 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 107. )
GGAAAACTTCAAAGAAAATCCAGAAGCTTTGTTCCGGAGCGTCAGGCCACGAGTCGTTGCTCCACAGAAAACTCTACCGACAAAGAAACCAGCCGTACCA[A/G]
CGCCACTGACCTTCAAGACAATGGCCAGCAAGACTCTTCGCGAGTTCGCTTTTCCCTCTGCTGACAATGTGGCCGTCGAGCCACAAGTCAACATAGGAGA
TCTCCTATGTTGACTTGTGGCTCGACGGCCACATTGTCAGCAGAGGGAAAAGCGAACTCGCGAAGAGTCTTGCTGGCCATTGTCTTGAAGGTCAGTGGCG[T/C]
TGGTACGGCTGGTTTCTTTGTCGGTAGAGTTTTCTGTGGAGCAACGACTCGTGGCCTGACGCTCCGGAACAAAGCTTCTGGATTTTCTTTGAAGTTTTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.50% | 26.40% | 32.04% | 3.11% | NA |
| All Indica | 2759 | 21.40% | 25.90% | 47.84% | 4.86% | NA |
| All Japonica | 1512 | 73.30% | 23.40% | 2.91% | 0.33% | NA |
| Aus | 269 | 0.40% | 54.30% | 42.75% | 2.60% | NA |
| Indica I | 595 | 21.20% | 12.90% | 61.34% | 4.54% | NA |
| Indica II | 465 | 18.50% | 16.30% | 60.43% | 4.73% | NA |
| Indica III | 913 | 22.50% | 40.10% | 32.42% | 5.04% | NA |
| Indica Intermediate | 786 | 22.10% | 24.80% | 48.09% | 4.96% | NA |
| Temperate Japonica | 767 | 60.20% | 37.00% | 2.35% | 0.39% | NA |
| Tropical Japonica | 504 | 93.30% | 2.00% | 4.56% | 0.20% | NA |
| Japonica Intermediate | 241 | 73.40% | 24.90% | 1.24% | 0.41% | NA |
| VI/Aromatic | 96 | 84.40% | 8.30% | 7.29% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 26.70% | 31.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114869807 | A -> DEL | N | N | silent_mutation | Average:13.224; most accessible tissue: Callus, score: 28.052 | N | N | N | N |
| vg1114869807 | A -> G | LOC_Os11g26000.1 | upstream_gene_variant ; 21.0bp to feature; MODIFIER | silent_mutation | Average:13.224; most accessible tissue: Callus, score: 28.052 | N | N | N | N |
| vg1114869807 | A -> G | LOC_Os11g26010.1 | upstream_gene_variant ; 4801.0bp to feature; MODIFIER | silent_mutation | Average:13.224; most accessible tissue: Callus, score: 28.052 | N | N | N | N |
| vg1114869807 | A -> G | LOC_Os11g25990-LOC_Os11g26000 | intergenic_region ; MODIFIER | silent_mutation | Average:13.224; most accessible tissue: Callus, score: 28.052 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114869807 | NA | 1.21E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869807 | NA | 1.82E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869807 | 3.41E-06 | NA | mr1401 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114869807 | NA | 3.33E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |