Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114506509:

Variant ID: vg1114506509 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 14506509
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATATACCTTCGATCTCGCACAACCGTTGCGCGAAACCGAGATTGGTGTGACGTCATGGGCGGTACCGCGCGTTGAAAGTGCGAGAACGCGCGGTCTAG[C/T]
GCGACGAAGGCACGAGAGCGCGCGGTTTCGCGCAATGAAAGAGCGAGACCGTTCGGTCTCGCGGAATCAAATTGCGTAAATGTCCACAGGCTCCATTTAA

Reverse complement sequence

TTAAATGGAGCCTGTGGACATTTACGCAATTTGATTCCGCGAGACCGAACGGTCTCGCTCTTTCATTGCGCGAAACCGCGCGCTCTCGTGCCTTCGTCGC[G/A]
CTAGACCGCGCGTTCTCGCACTTTCAACGCGCGGTACCGCCCATGACGTCACACCAATCTCGGTTTCGCGCAACGGTTGTGCGAGATCGAAGGTATATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 1.50% 0.63% 0.00% NA
All Indica  2759 96.40% 2.50% 1.05% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.30% 0.00% 2.69% 0.00% NA
Indica II  465 89.50% 9.00% 1.51% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 96.10% 3.30% 0.64% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1114506509 C -> T LOC_Os11g25440.1 upstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:80.43; most accessible tissue: Minghui63 panicle, score: 98.566 N N N N
vg1114506509 C -> T LOC_Os11g25454.1 downstream_gene_variant ; 3253.0bp to feature; MODIFIER silent_mutation Average:80.43; most accessible tissue: Minghui63 panicle, score: 98.566 N N N N
vg1114506509 C -> T LOC_Os11g25440-LOC_Os11g25454 intergenic_region ; MODIFIER silent_mutation Average:80.43; most accessible tissue: Minghui63 panicle, score: 98.566 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1114506509 C T -0.03 -0.01 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1114506509 NA 2.29E-06 mr1090 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 4.35E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 5.61E-06 mr1297 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 3.68E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 3.27E-06 mr1432 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 8.48E-09 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 2.14E-06 mr1956 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 1.57E-07 mr1958 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 5.76E-06 2.97E-09 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 9.88E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 9.79E-06 9.79E-06 mr1596_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 3.32E-08 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114506509 NA 8.84E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251