Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114404010:

Variant ID: vg1114404010 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14404010
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CACCTTCCTCCACGACAATGCAGACGTGTTCGCTTGGCAGCCGTCCAACATGCCCGGGGTCCCCAGGGAGGTGATTGAGCACAAACTCATGGTGCGACCC[A/G,T]
ATGCCAAGCCAATAAAACAAAAATGCGGAGATTTGCACCAGACCGGAAACAACCCATACGAGAAGAGCTCGACAAGCTTCTCAAAGCTGGCTTCATCAGA

Reverse complement sequence

TCTGATGAAGCCAGCTTTGAGAAGCTTGTCGAGCTCTTCTCGTATGGGTTGTTTCCGGTCTGGTGCAAATCTCCGCATTTTTGTTTTATTGGCTTGGCAT[T/C,A]
GGGTCGCACCATGAGTTTGTGCTCAATCACCTCCCTGGGGACCCCGGGCATGTTGGACGGCTGCCAAGCGAACACGTCTGCATTGTCGTGGAGGAAGGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	29.60%	1.21%	6.45%	T: 0.06%
All Indica	2759	93.10%	1.60%	1.70%	3.48%	T: 0.11%
All Japonica	1512	3.70%	83.10%	0.53%	12.63%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.80%	2.90%	1.34%	3.03%	NA
Indica II	465	94.60%	0.40%	1.94%	3.01%	NA
Indica III	913	93.60%	0.50%	1.64%	3.83%	T: 0.33%
Indica Intermediate	786	91.90%	2.50%	1.91%	3.69%	NA
Temperate Japonica	767	4.00%	80.80%	0.78%	14.34%	NA
Tropical Japonica	504	3.60%	90.30%	0.20%	5.95%	NA
Japonica Intermediate	241	2.90%	75.50%	0.41%	21.16%	NA
VI/Aromatic	96	15.60%	66.70%	1.04%	16.67%	NA
Intermediate	90	60.00%	36.70%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114404010	A -> T	LOC_Os11g25280.1	upstream_gene_variant ; 240.0bp to feature; MODIFIER	silent_mutation	Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N
vg1114404010	A -> T	LOC_Os11g25270.1	downstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N
vg1114404010	A -> T	LOC_Os11g25270-LOC_Os11g25280	intergenic_region ; MODIFIER	silent_mutation	Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N
vg1114404010	A -> DEL	N	N	silent_mutation	Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N
vg1114404010	A -> G	LOC_Os11g25280.1	upstream_gene_variant ; 240.0bp to feature; MODIFIER	silent_mutation	Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N
vg1114404010	A -> G	LOC_Os11g25270.1	downstream_gene_variant ; 115.0bp to feature; MODIFIER	silent_mutation	Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N
vg1114404010	A -> G	LOC_Os11g25270-LOC_Os11g25280	intergenic_region ; MODIFIER	silent_mutation	Average:58.987; most accessible tissue: Zhenshan97 flag leaf, score: 86.115	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114404010	NA	8.91E-22	mr1168	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	3.72E-18	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	1.04E-06	mr1527	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	1.00E-10	mr1553	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	4.15E-21	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	1.19E-06	NA	mr1742	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	7.09E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	1.37E-06	mr1796	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	2.85E-20	mr1817	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	2.41E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	5.73E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	3.90E-18	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	4.92E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114404010	NA	2.90E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251