Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1114265238:

Variant ID: vg1114265238 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 14265238
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACTAAAAGTCCATTAAACTTCCTACAAACGCTCCTAAACCGCCATGTGGCGCTCCTATAAACGCTCCTAGATTGCCATGTGGCGCTTTAATAAATCCTA[T/G]
AAATTATAAGAAAAAAGCAAAACATCTAGCCATCGATTTTCATTTAATCTGGTGGACCCACTATTTTAAACCATTAGATTTTGTTAAGAAAAAACCCAAA

Reverse complement sequence

TTTGGGTTTTTTCTTAACAAAATCTAATGGTTTAAAATAGTGGGTCCACCAGATTAAATGAAAATCGATGGCTAGATGTTTTGCTTTTTTCTTATAATTT[A/C]
TAGGATTTATTAAAGCGCCACATGGCAATCTAGGAGCGTTTATAGGAGCGCCACATGGCGGTTTAGGAGCGTTTGTAGGAAGTTTAATGGACTTTTAGTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.40%	9.40%	3.55%	0.68%	NA
All Indica	2759	98.60%	0.20%	0.98%	0.29%	NA
All Japonica	1512	63.00%	28.40%	8.66%	0.00%	NA
Aus	269	91.40%	0.00%	0.00%	8.55%	NA
Indica I	595	99.20%	0.20%	0.67%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.70%	0.10%	0.00%	0.22%	NA
Indica Intermediate	786	96.20%	0.30%	2.80%	0.76%	NA
Temperate Japonica	767	39.60%	49.50%	10.82%	0.00%	NA
Tropical Japonica	504	92.50%	2.40%	5.16%	0.00%	NA
Japonica Intermediate	241	75.50%	15.40%	9.13%	0.00%	NA
VI/Aromatic	96	92.70%	2.10%	5.21%	0.00%	NA
Intermediate	90	86.70%	6.70%	5.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1114265238	T -> DEL	N	N	silent_mutation	Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg1114265238	T -> G	LOC_Os11g25040.1	upstream_gene_variant ; 2499.0bp to feature; MODIFIER	silent_mutation	Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg1114265238	T -> G	LOC_Os11g25050.1	downstream_gene_variant ; 4803.0bp to feature; MODIFIER	silent_mutation	Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N
vg1114265238	T -> G	LOC_Os11g25020-LOC_Os11g25040	intergenic_region ; MODIFIER	silent_mutation	Average:38.997; most accessible tissue: Minghui63 young leaf, score: 48.378	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1114265238	NA	1.74E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238	NA	1.39E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238	NA	6.38E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238	6.46E-07	NA	mr1768	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238	NA	6.30E-06	mr1768	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238	NA	6.93E-10	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1114265238	NA	6.89E-06	mr1576_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251