Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113389475:

Variant ID: vg1113389475 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 13389475
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TGGAGGGAGGAGACTGATTTTCTTGAGAAGAGGGAGGAAGAACGGTTTCTTGAAGAGGGGAGTACACAGATGCATTTTAAAGTTTAACCCTCCACATGCA[G/A]
TAACACTATAGCATCATGGTGGGAAAGATTTTAAAAAATAATACATATCTTGTGAGATATTGCTTTTCAAAGATTGGCATTTTGAACTTTAACCCTCCAC

Reverse complement sequence

GTGGAGGGTTAAAGTTCAAAATGCCAATCTTTGAAAAGCAATATCTCACAAGATATGTATTATTTTTTAAAATCTTTCCCACCATGATGCTATAGTGTTA[C/T]
TGCATGTGGAGGGTTAAACTTTAAAATGCATCTGTGTACTCCCCTCTTCAAGAAACCGTTCTTCCTCCCTCTTCTCAAGAAAATCAGTCTCCTCCCTCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	5.20%	2.18%	0.00%	NA
All Indica	2759	87.80%	8.70%	3.55%	0.00%	NA
All Japonica	1512	99.70%	0.10%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.90%	0.20%	7.90%	0.00%	NA
Indica II	465	80.20%	13.50%	6.24%	0.00%	NA
Indica III	913	89.60%	10.20%	0.22%	0.00%	NA
Indica Intermediate	786	87.00%	10.40%	2.54%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1113389475	G -> A	LOC_Os11g23230.1	upstream_gene_variant ; 2963.0bp to feature; MODIFIER	silent_mutation	Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1113389475	G -> A	LOC_Os11g23232.1	downstream_gene_variant ; 1125.0bp to feature; MODIFIER	silent_mutation	Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1113389475	G -> A	LOC_Os11g23234.1	downstream_gene_variant ; 2561.0bp to feature; MODIFIER	silent_mutation	Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg1113389475	G -> A	LOC_Os11g23230-LOC_Os11g23232	intergenic_region ; MODIFIER	silent_mutation	Average:28.827; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1113389475	NA	7.78E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475	NA	9.68E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475	8.16E-06	7.01E-06	mr1117_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475	4.12E-06	NA	mr1119_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475	4.51E-06	NA	mr1120_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113389475	3.29E-06	NA	mr1247_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251