Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113156611:

Variant ID: vg1113156611 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 13156611
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTCCAACTTTATGATACTCTAATCTTGTTTATGTAATTCGTCGAGTTGTCATATATCTTATATAATCTTTGACAATTTTGTTATTTAACCTTCAATCG[G/A]
CTAACATCTATCATTGGAAGGCAGCCGATTAGGTTAAATACCAACGTTGACCTAGATTATATAAGATATCCACCACCCTATGAAACACTGAACGGCTTGA

Reverse complement sequence

TCAAGCCGTTCAGTGTTTCATAGGGTGGTGGATATCTTATATAATCTAGGTCAACGTTGGTATTTAACCTAATCGGCTGCCTTCCAATGATAGATGTTAG[C/T]
CGATTGAAGGTTAAATAACAAAATTGTCAAAGATTATATAAGATATATGACAACTCGACGAATTACATAAACAAGATTAGAGTATCATAAAGTTGGAAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.10%	0.80%	5.35%	25.69%	NA
All Indica	2759	49.00%	1.40%	8.74%	40.88%	NA
All Japonica	1512	96.30%	0.00%	0.33%	3.37%	NA
Aus	269	92.90%	0.40%	1.49%	5.20%	NA
Indica I	595	24.90%	0.80%	9.92%	64.37%	NA
Indica II	465	67.30%	0.90%	7.31%	24.52%	NA
Indica III	913	51.20%	2.20%	9.75%	36.91%	NA
Indica Intermediate	786	53.90%	1.10%	7.51%	37.40%	NA
Temperate Japonica	767	97.00%	0.00%	0.00%	3.00%	NA
Tropical Japonica	504	94.00%	0.00%	0.99%	4.96%	NA
Japonica Intermediate	241	98.80%	0.00%	0.00%	1.24%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	74.40%	0.00%	2.22%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1113156611	G -> A	LOC_Os11g22870.1	upstream_gene_variant ; 932.0bp to feature; MODIFIER	silent_mutation	Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1113156611	G -> A	LOC_Os11g22880.1	upstream_gene_variant ; 3834.0bp to feature; MODIFIER	silent_mutation	Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1113156611	G -> A	LOC_Os11g22870-LOC_Os11g22880	intergenic_region ; MODIFIER	silent_mutation	Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N
vg1113156611	G -> DEL	N	N	silent_mutation	Average:19.267; most accessible tissue: Minghui63 young leaf, score: 44.63	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1113156611	3.72E-07	NA	mr1682	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113156611	5.10E-06	NA	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251