Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112948764:

Variant ID: vg1112948764 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 12948764
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

AGAAATAAAAGAATATATTATATATCTACAGAAAATTATCTACAACTTTTGTGTTTTTGAGAACAATTTAATTAGGGACTACTTTTGAATTACCCTTGCA[A/G]
CAAGGAACATCAATTCGAGACGAATTTCCACCTTTTCTTCCCTACTCTTCTTTGGAACCGATAAAAAATGTCCTGACAGTTGTCTTCTATTCTCCTCTTG

Reverse complement sequence

CAAGAGGAGAATAGAAGACAACTGTCAGGACATTTTTTATCGGTTCCAAAGAAGAGTAGGGAAGAAAAGGTGGAAATTCGTCTCGAATTGATGTTCCTTG[T/C]
TGCAAGGGTAATTCAAAAGTAGTCCCTAATTAAATTGTTCTCAAAAACACAAAAGTTGTAGATAATTTTCTGTAGATATATAATATATTCTTTTATTTCT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.80%	15.30%	0.36%	36.52%	NA
All Indica	2759	23.90%	16.60%	0.47%	59.01%	NA
All Japonica	1512	95.80%	1.30%	0.13%	2.84%	NA
Aus	269	5.60%	83.60%	0.00%	10.78%	NA
Indica I	595	48.40%	13.40%	0.50%	37.65%	NA
Indica II	465	30.30%	6.50%	0.65%	62.58%	NA
Indica III	913	3.40%	23.40%	0.66%	72.51%	NA
Indica Intermediate	786	25.40%	17.00%	0.13%	57.38%	NA
Temperate Japonica	767	97.10%	2.10%	0.13%	0.65%	NA
Tropical Japonica	504	92.70%	0.60%	0.20%	6.55%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	86.50%	12.50%	0.00%	1.04%	NA
Intermediate	90	57.80%	12.20%	2.22%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1112948764	A -> DEL	N	N	silent_mutation	Average:11.21; most accessible tissue: Callus, score: 73.772	N	N	N	N
vg1112948764	A -> G	LOC_Os11g22540.1	upstream_gene_variant ; 3015.0bp to feature; MODIFIER	silent_mutation	Average:11.21; most accessible tissue: Callus, score: 73.772	N	N	N	N
vg1112948764	A -> G	LOC_Os11g22530.1	intron_variant ; MODIFIER	silent_mutation	Average:11.21; most accessible tissue: Callus, score: 73.772	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1112948764	9.22E-06	NA	mr1197	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	2.95E-06	2.95E-06	mr1197	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	NA	2.15E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	NA	9.82E-07	mr1392	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	NA	1.91E-08	mr1442	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	NA	3.65E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	NA	2.41E-06	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	NA	1.72E-07	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	NA	4.60E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112948764	NA	4.60E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251