Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1112717844:

Variant ID: vg1112717844 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 12717844
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.28, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGTGGCCCACCTCTCATCCGCAATATATAACCCTAAATAATGATATCCCGTAATCTAGACACCACGCCTAAACTACCAGATACTACTCTAATATCATC[G/A]
TTATGACATAGAATAATTGCATAAGCAAACATTATACCCGCACCAAAGCATGTCCCAGATAAGCTAGCCGTATATTCAGTATAACATGAACATAATGTAA

Reverse complement sequence

TTACATTATGTTCATGTTATACTGAATATACGGCTAGCTTATCTGGGACATGCTTTGGTGCGGGTATAATGTTTGCTTATGCAATTATTCTATGTCATAA[C/T]
GATGATATTAGAGTAGTATCTGGTAGTTTAGGCGTGGTGTCTAGATTACGGGATATCATTATTTAGGGTTATATATTGCGGATGAGAGGTGGGCCACTGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	37.10%	1.50%	0.53%	NA
All Indica	2759	97.40%	2.40%	0.22%	0.00%	NA
All Japonica	1512	3.40%	94.80%	0.07%	1.65%	NA
Aus	269	30.50%	48.30%	21.19%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	99.00%	0.70%	0.33%	0.00%	NA
Indica Intermediate	786	94.10%	5.50%	0.38%	0.00%	NA
Temperate Japonica	767	3.70%	96.30%	0.00%	0.00%	NA
Tropical Japonica	504	3.60%	91.30%	0.20%	4.96%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	93.80%	2.08%	0.00%	NA
Intermediate	90	57.80%	36.70%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1112717844	G -> A	LOC_Os11g22170.1	downstream_gene_variant ; 4640.0bp to feature; MODIFIER	silent_mutation	Average:53.799; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg1112717844	G -> A	LOC_Os11g22160.1	intron_variant ; MODIFIER	silent_mutation	Average:53.799; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N
vg1112717844	G -> DEL	N	N	silent_mutation	Average:53.799; most accessible tissue: Minghui63 flag leaf, score: 74.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1112717844	NA	1.85E-19	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112717844	NA	4.95E-06	mr1029	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112717844	NA	1.31E-09	mr1047	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112717844	NA	4.01E-06	mr1189	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112717844	4.36E-06	NA	mr1684	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112717844	NA	7.24E-06	mr1782	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112717844	NA	1.29E-06	mr1990	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112717844	NA	5.47E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1112717844	NA	3.61E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251