Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1111902205:

Variant ID: vg1111902205 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 11902205
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCATGTAATCAAACTAACACACGTTCAATACAATCTCGGCGCATCGCCACTCTTTTATTTTCATTTTGTTTCGACGAGTTCTTGCTTTCAGGTTGAGCT[G/A]
CATAGGTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGGTGGCTTGCGTTCTCGGGATTAGTGCTTCCATCTTCATGATACTTTAATCTTGTTTATGT

Reverse complement sequence

ACATAAACAAGATTAAAGTATCATGAAGATGGAAGCACTAATCCCGAGAACGCAAGCCACCATAACAAGTTTTACCTCTTGTTGAAGATCGAAACCTATG[C/T]
AGCTCAACCTGAAAGCAAGAACTCGTCGAAACAAAATGAAAATAAAAGAGTGGCGATGCGCCGAGATTGTATTGAACGTGTGTTAGTTTGATTACATGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.30%	33.50%	1.33%	1.93%	NA
All Indica	2759	43.40%	54.80%	1.78%	0.00%	NA
All Japonica	1512	90.10%	3.20%	0.86%	5.82%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	18.80%	78.30%	2.86%	0.00%	NA
Indica II	465	63.40%	35.10%	1.51%	0.00%	NA
Indica III	913	43.50%	55.60%	0.88%	0.00%	NA
Indica Intermediate	786	50.10%	47.70%	2.16%	0.00%	NA
Temperate Japonica	767	86.00%	1.30%	1.43%	11.21%	NA
Tropical Japonica	504	92.90%	6.70%	0.40%	0.00%	NA
Japonica Intermediate	241	97.50%	1.70%	0.00%	0.83%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	71.10%	24.40%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1111902205	G -> A	LOC_Os11g20530.1	downstream_gene_variant ; 2322.0bp to feature; MODIFIER	silent_mutation	Average:23.385; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N
vg1111902205	G -> A	LOC_Os11g20520-LOC_Os11g20530	intergenic_region ; MODIFIER	silent_mutation	Average:23.385; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N
vg1111902205	G -> DEL	N	N	silent_mutation	Average:23.385; most accessible tissue: Minghui63 young leaf, score: 29.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1111902205	NA	8.10E-06	mr1097	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111902205	NA	1.03E-11	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111902205	4.59E-06	1.48E-09	mr1097_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111902205	NA	2.81E-06	mr1102_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111902205	NA	4.33E-06	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111902205	4.15E-06	NA	mr1154_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111902205	1.54E-08	4.07E-12	mr1154_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251