Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110245970:

Variant ID: vg1110245970 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10245970
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCAAGACGGGCGGAATGCGATATCGATACGGAGAGGAGAGCGCGACCTAGCTCCTCCAAATCGAGCACCGCTGCCACTACTCCCTCGCAGCGCACGCGT[T/C]
GCCGGCGCCGCCCCCTCTCCCCACAGACTCTGCTGCTCCCTCGTCTTGTGCGCTCCTCCAACCACCGCTTGGCCAGGCTGGCGCATCGATGCTCCCCACC

Reverse complement sequence

GGTGGGGAGCATCGATGCGCCAGCCTGGCCAAGCGGTGGTTGGAGGAGCGCACAAGACGAGGGAGCAGCAGAGTCTGTGGGGAGAGGGGGCGGCGCCGGC[A/G]
ACGCGTGCGCTGCGAGGGAGTAGTGGCAGCGGTGCTCGATTTGGAGGAGCTAGGTCGCGCTCTCCTCTCCGTATCGATATCGCATTCCGCCCGTCTTGGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.70%	35.20%	0.08%	0.00%	NA
All Indica	2759	93.70%	6.20%	0.14%	0.00%	NA
All Japonica	1512	6.20%	93.80%	0.00%	0.00%	NA
Aus	269	90.70%	9.30%	0.00%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	97.80%	2.00%	0.22%	0.00%	NA
Indica Intermediate	786	84.00%	15.80%	0.25%	0.00%	NA
Temperate Japonica	767	3.10%	96.90%	0.00%	0.00%	NA
Tropical Japonica	504	11.10%	88.90%	0.00%	0.00%	NA
Japonica Intermediate	241	5.40%	94.60%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	19.80%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110245970	T -> C	LOC_Os11g18194.1	intron_variant ; MODIFIER	silent_mutation	Average:68.013; most accessible tissue: Zhenshan97 young leaf, score: 89.666	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110245970	4.10E-06	NA	mr1101	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110245970	NA	8.96E-11	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110245970	NA	2.39E-08	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110245970	7.36E-06	7.36E-06	mr1918	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251