RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1110064581:

Variant ID: vg1110064581 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10064581
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTGTTATGCATCTTTAGTCTGGTTATTTCAACCGGGACTAAAGATGAGATTATGCGTCCCAGTTGCACAACCGAGACTAAAAACGGTTGCGAACCCTTCT[C/A]
CAGCAATGGTGGTGGATCCGCCGGTAGTTTCGAGTTATGACAACGACAAATTCTAGTGTTTTTGGATTCTTTTTGTTCTTTTTCAAAATTATGTTTTCAG

Reverse complement sequence

CTGAAAACATAATTTTGAAAAAGAACAAAAAGAATCCAAAAACACTAGAATTTGTCGTTGTCATAACTCGAAACTACCGGCGGATCCACCACCATTGCTG[G/T]
AGAAGGGTTCGCAACCGTTTTTAGTCTCGGTTGTGCAACTGGGACGCATAATCTCATCTTTAGTCCCGGTTGAAATAACCAGACTAAAGATGCATAACAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	6.20%	0.00%	0.00%	NA
All Indica	2759	97.80%	2.20%	0.00%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	20.10%	79.90%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.40%	0.60%	0.00%	0.00%	NA
Indica III	913	97.80%	2.20%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.80%	0.00%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110064581	C -> A	LOC_Os11g17930.1	upstream_gene_variant ; 3703.0bp to feature; MODIFIER	silent_mutation	Average:73.098; most accessible tissue: Zhenshan97 flower, score: 81.46	N	N	N	N
vg1110064581	C -> A	LOC_Os11g17920-LOC_Os11g17930	intergenic_region ; MODIFIER	silent_mutation	Average:73.098; most accessible tissue: Zhenshan97 flower, score: 81.46	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110064581	NA	1.01E-07	mr1004	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	3.67E-06	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	1.86E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	3.99E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	3.59E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	2.39E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	2.62E-07	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	3.92E-23	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	5.50E-35	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110064581	NA	2.16E-31	mr1099	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 91 entries

Previous1 2 3 4 5…10Next

Search for Variation information by Variation ID:

Detailed information for vg1110064581:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact