Variant ID: vg1110064581 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 10064581 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGTTATGCATCTTTAGTCTGGTTATTTCAACCGGGACTAAAGATGAGATTATGCGTCCCAGTTGCACAACCGAGACTAAAAACGGTTGCGAACCCTTCT[C/A]
CAGCAATGGTGGTGGATCCGCCGGTAGTTTCGAGTTATGACAACGACAAATTCTAGTGTTTTTGGATTCTTTTTGTTCTTTTTCAAAATTATGTTTTCAG
CTGAAAACATAATTTTGAAAAAGAACAAAAAGAATCCAAAAACACTAGAATTTGTCGTTGTCATAACTCGAAACTACCGGCGGATCCACCACCATTGCTG[G/T]
AGAAGGGTTCGCAACCGTTTTTAGTCTCGGTTGTGCAACTGGGACGCATAATCTCATCTTTAGTCCCGGTTGAAATAACCAGACTAAAGATGCATAACAA
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
All Indica | 2759 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Aus | 269 | 20.10% | 79.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Indica III | 913 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1110064581 | C -> A | LOC_Os11g17930.1 | upstream_gene_variant ; 3703.0bp to feature; MODIFIER | silent_mutation | Average:73.098; most accessible tissue: Zhenshan97 flower, score: 81.46 | N | N | N | N |
vg1110064581 | C -> A | LOC_Os11g17920-LOC_Os11g17930 | intergenic_region ; MODIFIER | silent_mutation | Average:73.098; most accessible tissue: Zhenshan97 flower, score: 81.46 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1110064581 | NA | 1.01E-07 | mr1004 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 3.67E-06 | mr1006 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 1.86E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 3.99E-06 | mr1052 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 3.59E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 2.39E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 2.62E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 3.92E-23 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 5.50E-35 | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1110064581 | NA | 2.16E-31 | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/