Search for Variation information by Variation ID:
Detailed information for vg1110033896:
| Variant ID: vg1110033896 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 10033896 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
CAAATGGAGCATGAATTTCATGATTATTTTAAAGATGCAAGCTTGATGGAGCAAAGACCGATTGATACTTCATCGGTCACGTGTGAAACTATTTCGGTTA[C/T]
ACCTATGCCTAAGACCGGAATTGTTAGTAATTTTCTCCCTATTAGTCCTATTGATGTTGACAAAAAGAAAGGGAAAAGTGTTATTATTGGGGATCCTCGG
Reverse complement sequence
CCGAGGATCCCCAATAATAACACTTTTCCCTTTCTTTTTGTCAACATCAATAGGACTAATAGGGAGAAAATTACTAACAATTCCGGTCTTAGGCATAGGT[G/A]
TAACCGAAATAGTTTCACACGTGACCGATGAAGTATCAATCGGTCTTTGCTCCATCAAGCTTGCATCTTTAAAATAATCATGAAATTCATGCTCCATTTG
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.70% | 2.70% | 33.01% | 9.65% | NA |
| All Indica | 2759 | 42.30% | 0.10% | 48.24% | 9.31% | NA |
| All Japonica | 1512 | 82.70% | 3.20% | 3.11% | 10.98% | NA |
| Aus | 269 | 34.20% | 0.00% | 56.13% | 9.67% | NA |
| Indica I | 595 | 58.00% | 0.00% | 31.76% | 10.25% | NA |
| Indica II | 465 | 37.20% | 0.00% | 50.54% | 12.26% | NA |
| Indica III | 913 | 30.70% | 0.00% | 61.45% | 7.89% | NA |
| Indica Intermediate | 786 | 46.90% | 0.50% | 44.02% | 8.52% | NA |
| Temperate Japonica | 767 | 73.30% | 4.80% | 4.43% | 17.47% | NA |
| Tropical Japonica | 504 | 97.40% | 0.40% | 1.39% | 0.79% | NA |
| Japonica Intermediate | 241 | 81.70% | 4.10% | 2.49% | 11.62% | NA |
| VI/Aromatic | 96 | 21.90% | 70.80% | 6.25% | 1.04% | NA |
| Intermediate | 90 | 58.90% | 6.70% | 27.78% | 6.67% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1110033896 | C -> T | LOC_Os11g17890.1 | missense_variant ; p.Thr549Ile; MODERATE | nonsynonymous_codon ; T549I | Average:8.248; most accessible tissue: Minghui63 young leaf, score: 14.915 | possibly damaging  |
1.888 |
DELETERIOUS | 0.02 |
| vg1110033896 | C -> DEL | LOC_Os11g17890.1 | N | frameshift_variant | Average:8.248; most accessible tissue: Minghui63 young leaf, score: 14.915 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1110033896 | NA | 1.56E-06 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110033896 | 4.30E-06 | 6.86E-06 | mr1495 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110033896 | NA | 5.41E-07 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1110033896 | NA | 8.51E-06 | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |