Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1110030990:

Variant ID: vg1110030990 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 10030990
Reference Allele: A	Alternative Allele: G,C
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 55. )

Flanking Sequence (100 bp) in Reference Genome:

ATCGATCTAAATCGGCCTAGAGGCTGGTTTTGATCTCTAAATCGGCTCTGCTAGCCGGTTTAGCTGTTTTTCTACAAAACCCATCTTGATTTGGCCGTTT[A/G,C]
GCTAGATCGAGGTGGTTGGCGACTCCATTTCACCGCAAGGCATTTAGGTGTTGCGATCGTGCTTATCGACTTGTCAAAAAAGTTGCCAACACGATTTTTG

Reverse complement sequence

CAAAAATCGTGTTGGCAACTTTTTTGACAAGTCGATAAGCACGATCGCAACACCTAAATGCCTTGCGGTGAAATGGAGTCGCCAACCACCTCGATCTAGC[T/C,G]
AAACGGCCAAATCAAGATGGGTTTTGTAGAAAAACAGCTAAACCGGCTAGCAGAGCCGATTTAGAGATCAAAACCAGCCTCTAGGCCGATTTAGATCGAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.00%	0.10%	4.49%	49.32%	C: 0.06%
All Indica	2759	24.50%	0.10%	5.58%	69.63%	C: 0.11%
All Japonica	1512	86.00%	0.10%	2.65%	11.31%	NA
Aus	269	21.20%	0.00%	6.32%	72.49%	NA
Indica I	595	46.70%	0.00%	2.02%	51.26%	NA
Indica II	465	22.80%	0.00%	4.73%	72.47%	NA
Indica III	913	5.30%	0.30%	8.65%	85.43%	C: 0.33%
Indica Intermediate	786	31.20%	0.10%	5.22%	63.49%	NA
Temperate Japonica	767	78.90%	0.10%	4.30%	16.69%	NA
Tropical Japonica	504	97.00%	0.00%	0.00%	2.98%	NA
Japonica Intermediate	241	85.50%	0.00%	2.90%	11.62%	NA
VI/Aromatic	96	90.60%	0.00%	1.04%	8.33%	NA
Intermediate	90	60.00%	0.00%	0.00%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1110030990	A -> DEL	N	N	silent_mutation	Average:12.497; most accessible tissue: Callus, score: 26.238	N	N	N	N
vg1110030990	A -> G	LOC_Os11g17890.1	upstream_gene_variant ; 1096.0bp to feature; MODIFIER	silent_mutation	Average:12.497; most accessible tissue: Callus, score: 26.238	N	N	N	N
vg1110030990	A -> G	LOC_Os11g17880-LOC_Os11g17890	intergenic_region ; MODIFIER	silent_mutation	Average:12.497; most accessible tissue: Callus, score: 26.238	N	N	N	N
vg1110030990	A -> C	LOC_Os11g17890.1	upstream_gene_variant ; 1096.0bp to feature; MODIFIER	silent_mutation	Average:12.497; most accessible tissue: Callus, score: 26.238	N	N	N	N
vg1110030990	A -> C	LOC_Os11g17880-LOC_Os11g17890	intergenic_region ; MODIFIER	silent_mutation	Average:12.497; most accessible tissue: Callus, score: 26.238	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1110030990	5.15E-06	4.47E-07	mr1201	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990	NA	1.28E-07	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990	NA	9.00E-08	mr1382	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990	NA	2.71E-06	mr1884	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990	NA	2.77E-06	mr1456_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1110030990	NA	3.56E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251