Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109959621:

Variant ID: vg1109959621 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9959621
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCAATAGTATATGTTCTGATATCTTCATGAAATTCATTATTAAACTGACAACAACCCTTCAAAGCTGAACACTATATCGCTCATCCATTAGACCAGCT[A/G]
ATGCTACTACTATTTTTTTTCTGAGGAGCCAAATTGCTGCATAGGTATGTTTGATGGCCCTACGATTTAATTTGATAGCTCTGCTACATGTATACTTGAT

Reverse complement sequence

ATCAAGTATACATGTAGCAGAGCTATCAAATTAAATCGTAGGGCCATCAAACATACCTATGCAGCAATTTGGCTCCTCAGAAAAAAAATAGTAGTAGCAT[T/C]
AGCTGGTCTAATGGATGAGCGATATAGTGTTCAGCTTTGAAGGGTTGTTGTCAGTTTAATAATGAATTTCATGAAGATATCAGAACATATACTATTGCTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.80%	6.00%	0.57%	54.63%	NA
All Indica	2759	11.80%	7.70%	0.80%	79.70%	NA
All Japonica	1512	93.50%	3.00%	0.07%	3.44%	NA
Aus	269	14.90%	6.30%	1.12%	77.70%	NA
Indica I	595	18.20%	6.20%	2.02%	73.61%	NA
Indica II	465	5.80%	4.50%	1.08%	88.60%	NA
Indica III	913	2.80%	12.00%	0.11%	84.99%	NA
Indica Intermediate	786	21.00%	5.60%	0.51%	72.90%	NA
Temperate Japonica	767	93.00%	3.80%	0.13%	3.13%	NA
Tropical Japonica	504	93.80%	3.00%	0.00%	3.17%	NA
Japonica Intermediate	241	94.60%	0.40%	0.00%	4.98%	NA
VI/Aromatic	96	21.90%	0.00%	0.00%	78.12%	NA
Intermediate	90	37.80%	8.90%	1.11%	52.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109959621	A -> DEL	N	N	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 26.563	N	N	N	N
vg1109959621	A -> G	LOC_Os11g17780.1	upstream_gene_variant ; 4925.0bp to feature; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 26.563	N	N	N	N
vg1109959621	A -> G	LOC_Os11g17799.1	upstream_gene_variant ; 1553.0bp to feature; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 26.563	N	N	N	N
vg1109959621	A -> G	LOC_Os11g17799.2	upstream_gene_variant ; 1553.0bp to feature; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 26.563	N	N	N	N
vg1109959621	A -> G	LOC_Os11g17790.1	downstream_gene_variant ; 2394.0bp to feature; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 26.563	N	N	N	N
vg1109959621	A -> G	LOC_Os11g17810.1	downstream_gene_variant ; 3158.0bp to feature; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 26.563	N	N	N	N
vg1109959621	A -> G	LOC_Os11g17790-LOC_Os11g17799	intergenic_region ; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 26.563	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109959621	5.60E-06	NA	mr1114	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621	4.78E-06	1.04E-16	mr1116	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621	NA	2.19E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621	NA	1.84E-09	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621	2.47E-06	NA	mr1247	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621	NA	3.53E-06	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621	NA	2.34E-22	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621	NA	6.30E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621	NA	2.51E-14	mr1936_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251