Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109959621:

Variant ID: vg1109959621 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9959621
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.74, A: 0.26, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


TAGCAATAGTATATGTTCTGATATCTTCATGAAATTCATTATTAAACTGACAACAACCCTTCAAAGCTGAACACTATATCGCTCATCCATTAGACCAGCT[A/G]
ATGCTACTACTATTTTTTTTCTGAGGAGCCAAATTGCTGCATAGGTATGTTTGATGGCCCTACGATTTAATTTGATAGCTCTGCTACATGTATACTTGAT

Reverse complement sequence

ATCAAGTATACATGTAGCAGAGCTATCAAATTAAATCGTAGGGCCATCAAACATACCTATGCAGCAATTTGGCTCCTCAGAAAAAAAATAGTAGTAGCAT[T/C]
AGCTGGTCTAATGGATGAGCGATATAGTGTTCAGCTTTGAAGGGTTGTTGTCAGTTTAATAATGAATTTCATGAAGATATCAGAACATATACTATTGCTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.80% 6.00% 0.57% 54.63% NA
All Indica  2759 11.80% 7.70% 0.80% 79.70% NA
All Japonica  1512 93.50% 3.00% 0.07% 3.44% NA
Aus  269 14.90% 6.30% 1.12% 77.70% NA
Indica I  595 18.20% 6.20% 2.02% 73.61% NA
Indica II  465 5.80% 4.50% 1.08% 88.60% NA
Indica III  913 2.80% 12.00% 0.11% 84.99% NA
Indica Intermediate  786 21.00% 5.60% 0.51% 72.90% NA
Temperate Japonica  767 93.00% 3.80% 0.13% 3.13% NA
Tropical Japonica  504 93.80% 3.00% 0.00% 3.17% NA
Japonica Intermediate  241 94.60% 0.40% 0.00% 4.98% NA
VI/Aromatic  96 21.90% 0.00% 0.00% 78.12% NA
Intermediate  90 37.80% 8.90% 1.11% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109959621 A -> DEL N N silent_mutation Average:8.263; most accessible tissue: Callus, score: 26.563 N N N N
vg1109959621 A -> G LOC_Os11g17780.1 upstream_gene_variant ; 4925.0bp to feature; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 26.563 N N N N
vg1109959621 A -> G LOC_Os11g17799.1 upstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 26.563 N N N N
vg1109959621 A -> G LOC_Os11g17799.2 upstream_gene_variant ; 1553.0bp to feature; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 26.563 N N N N
vg1109959621 A -> G LOC_Os11g17790.1 downstream_gene_variant ; 2394.0bp to feature; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 26.563 N N N N
vg1109959621 A -> G LOC_Os11g17810.1 downstream_gene_variant ; 3158.0bp to feature; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 26.563 N N N N
vg1109959621 A -> G LOC_Os11g17790-LOC_Os11g17799 intergenic_region ; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 26.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109959621 5.60E-06 NA mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621 4.78E-06 1.04E-16 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621 NA 2.19E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621 NA 1.84E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621 2.47E-06 NA mr1247 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621 NA 3.53E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621 NA 2.34E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621 NA 6.30E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109959621 NA 2.51E-14 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251