Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109955379:

Variant ID: vg1109955379 (JBrowse)	Variation Type: INDEL
Chromosome: chr11	Position: 9955379
Reference Allele: T	Alternative Allele: C,TATGTATACA,TA,TATG,TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAAGCTAAGTAGAAAGAATAAAAAAAGGAAATCTATTCCTATACTTCTAGTATACATAATATACATACATTCTAGATATCTGATATACTAGCTAATACC[T/C,TATGTATACA,TA,TATG,TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC]
TCTATCCGATGCTCTCATGGTACTTCGAAAAGCCACTCCTGACTGCCGAGCTTCTTACGACAGCCCGTCATGACCATACAACCGGGGCTAAATACGGAGG

Reverse complement sequence

CCTCCGTATTTAGCCCCGGTTGTATGGTCATGACGGGCTGTCGTAAGAAGCTCGGCAGTCAGGAGTGGCTTTTCGAAGTACCATGAGAGCATCGGATAGA[A/G,TGTATACATA,TA,CATA,GGGTATTAGCTAGTATATCAGATAACTAGAATGTATGTATACATA]
GGTATTAGCTAGTATATCAGATATCTAGAATGTATGTATATTATGTATACTAGAAGTATAGGAATAGATTTCCTTTTTTTATTCTTTCTACTTAGCTTAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	40.70%	4.30%	2.03%	52.67%	TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC: 0.11%; TA: 0.11%; TATGTATACA: 0.06%; TATG: 0.02%
All Indica	2759	13.40%	6.60%	2.39%	77.17%	TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC: 0.18%; TA: 0.14%; TATGTATACA: 0.11%
All Japonica	1512	95.80%	0.70%	0.13%	3.24%	TA: 0.07%
Aus	269	17.80%	1.90%	8.92%	71.38%	NA
Indica I	595	20.80%	5.90%	1.85%	71.43%	NA
Indica II	465	8.40%	1.50%	3.01%	86.24%	TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC: 0.43%; TA: 0.43%
Indica III	913	2.80%	11.30%	2.30%	83.02%	TATGTATACA: 0.33%; TA: 0.22%
Indica Intermediate	786	23.00%	4.70%	2.54%	69.34%	TATGTATACATACATTCTAGTTATCTGATATACTAGCTAATACCC: 0.38%
Temperate Japonica	767	97.00%	0.00%	0.13%	2.87%	NA
Tropical Japonica	504	94.40%	2.20%	0.00%	3.17%	TA: 0.20%
Japonica Intermediate	241	95.00%	0.00%	0.41%	4.56%	NA
VI/Aromatic	96	19.80%	0.00%	1.04%	78.12%	TATG: 1.04%
Intermediate	90	42.20%	5.60%	3.33%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109955379	T -> TA	LOC_Os11g17770.1	upstream_gene_variant ; 4843.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TA	LOC_Os11g17780.1	upstream_gene_variant ; 684.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TA	LOC_Os11g17790.1	upstream_gene_variant ; 1644.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TA	LOC_Os11g17780-LOC_Os11g17790	intergenic_region ; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATG	LOC_Os11g17770.1	upstream_gene_variant ; 4843.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATG	LOC_Os11g17780.1	upstream_gene_variant ; 684.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATG	LOC_Os11g17790.1	upstream_gene_variant ; 1644.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATG	LOC_Os11g17780-LOC_Os11g17790	intergenic_region ; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATGTATACA	LOC_Os11g17770.1	upstream_gene_variant ; 4843.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATGTATACA	LOC_Os11g17780.1	upstream_gene_variant ; 684.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATGTATACA	LOC_Os11g17790.1	upstream_gene_variant ; 1644.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATGTATACA	LOC_Os11g17780-LOC_Os11g17790	intergenic_region ; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATGTATACATACATTCTAGTTATCTGATA TACTAGCTAATACCC	LOC_Os11g17770.1	upstream_gene_variant ; 4843.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATGTATACATACATTCTAGTTATCTGATA TACTAGCTAATACCC	LOC_Os11g17780.1	upstream_gene_variant ; 684.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATGTATACATACATTCTAGTTATCTGATA TACTAGCTAATACCC	LOC_Os11g17790.1	upstream_gene_variant ; 1644.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> TATGTATACATACATTCTAGTTATCTGATA TACTAGCTAATACCC	LOC_Os11g17780-LOC_Os11g17790	intergenic_region ; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> DEL	N	N	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> C	LOC_Os11g17770.1	upstream_gene_variant ; 4842.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> C	LOC_Os11g17780.1	upstream_gene_variant ; 683.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> C	LOC_Os11g17790.1	upstream_gene_variant ; 1645.0bp to feature; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N
vg1109955379	T -> C	LOC_Os11g17780-LOC_Os11g17790	intergenic_region ; MODIFIER	silent_mutation	Average:17.789; most accessible tissue: Callus, score: 36.203	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109955379	2.68E-06	NA	mr1155	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251