Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109561136:

Variant ID: vg1109561136 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9561136
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:

TGTTTTTGTGTCCAGACAACATAAGCACCGCACGCGAAAATCCGATTTTTTTGTGCAGAAGCACCACCCACACACAAAAATAGCGATTTTCGCAACATCT[G/A]
GATGCGTACATGCCGCTCAGCCGCCTGCAAAAATCGGTTTTAAGCATAAGATAAAATGGTTTTTTTAAGTTGTGGTGTAGAGGTGAGCAGGAGGAATGAG

Reverse complement sequence

CTCATTCCTCCTGCTCACCTCTACACCACAACTTAAAAAAACCATTTTATCTTATGCTTAAAACCGATTTTTGCAGGCGGCTGAGCGGCATGTACGCATC[C/T]
AGATGTTGCGAAAATCGCTATTTTTGTGTGTGGGTGGTGCTTCTGCACAAAAAAATCGGATTTTCGCGTGCGGTGCTTATGTTGTCTGGACACAAAAACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.90%	10.10%	0.19%	1.88%	NA
All Indica	2759	82.90%	16.50%	0.07%	0.47%	NA
All Japonica	1512	98.10%	0.70%	0.13%	1.12%	NA
Aus	269	98.50%	1.10%	0.00%	0.37%	NA
Indica I	595	69.60%	28.10%	0.34%	2.02%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	83.00%	17.00%	0.00%	0.00%	NA
Indica Intermediate	786	83.60%	16.30%	0.00%	0.13%	NA
Temperate Japonica	767	99.10%	0.80%	0.00%	0.13%	NA
Tropical Japonica	504	97.40%	0.60%	0.20%	1.79%	NA
Japonica Intermediate	241	96.30%	0.40%	0.41%	2.90%	NA
VI/Aromatic	96	37.50%	1.00%	4.17%	57.29%	NA
Intermediate	90	90.00%	5.60%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109561136	G -> A	LOC_Os11g17180.1	upstream_gene_variant ; 3354.0bp to feature; MODIFIER	silent_mutation	Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975	N	N	N	N
vg1109561136	G -> A	LOC_Os11g17180-LOC_Os11g17190	intergenic_region ; MODIFIER	silent_mutation	Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975	N	N	N	N
vg1109561136	G -> DEL	N	N	silent_mutation	Average:61.469; most accessible tissue: Zhenshan97 flower, score: 86.975	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109561136	NA	9.08E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136	NA	1.40E-07	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136	NA	5.46E-06	mr1214	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136	NA	1.03E-06	mr1611	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136	NA	8.99E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136	NA	8.05E-08	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136	NA	3.66E-08	mr1759	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136	NA	1.63E-07	mr1759	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109561136	NA	4.07E-06	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251