Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109493114:

Variant ID: vg1109493114 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9493114
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACGTCGTATCCTTCCACTGCCAATTAAGGACCCATTTGAATCAAAGAATTTATATAGAAATTTCATAGAATTTAAATCTTATAGGAAATTTTTCTATTTG[C/G]
CCCTTTGATTTAAAGGATCGAAGTTTTTCAAATCCTATAAAATTTCTATGGAATGGCACATTGCATGTGGATTTTGGAGGAAATTTAGCAACAGCTCCAA

Reverse complement sequence

TTGGAGCTGTTGCTAAATTTCCTCCAAAATCCACATGCAATGTGCCATTCCATAGAAATTTTATAGGATTTGAAAAACTTCGATCCTTTAAATCAAAGGG[G/C]
CAAATAGAAAAATTTCCTATAAGATTTAAATTCTATGAAATTTCTATATAAATTCTTTGATTCAAATGGGTCCTTAATTGGCAGTGGAAGGATACGACGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.10%	32.70%	0.34%	2.86%	NA
All Indica	2759	96.00%	1.60%	0.43%	1.92%	NA
All Japonica	1512	3.20%	95.40%	0.20%	1.12%	NA
Aus	269	95.90%	3.70%	0.00%	0.37%	NA
Indica I	595	92.80%	3.50%	0.17%	3.53%	NA
Indica II	465	98.30%	0.20%	0.43%	1.08%	NA
Indica III	913	97.80%	0.40%	0.22%	1.53%	NA
Indica Intermediate	786	95.00%	2.40%	0.89%	1.65%	NA
Temperate Japonica	767	3.30%	96.60%	0.00%	0.13%	NA
Tropical Japonica	504	4.00%	94.00%	0.40%	1.59%	NA
Japonica Intermediate	241	1.70%	94.60%	0.41%	3.32%	NA
VI/Aromatic	96	19.80%	18.80%	0.00%	61.46%	NA
Intermediate	90	61.10%	32.20%	1.11%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109493114	C -> DEL	N	N	silent_mutation	Average:54.16; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N
vg1109493114	C -> G	LOC_Os11g17100.1	downstream_gene_variant ; 2341.0bp to feature; MODIFIER	silent_mutation	Average:54.16; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N
vg1109493114	C -> G	LOC_Os11g17090-LOC_Os11g17100	intergenic_region ; MODIFIER	silent_mutation	Average:54.16; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109493114	NA	1.33E-11	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109493114	NA	7.84E-14	mr1909	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109493114	NA	2.81E-17	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251