Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109484212:

Variant ID: vg1109484212 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9484212
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTATAGTGGTTGTACTCATTCTTGCTCAATATTTCCCCCTCCTTTAGTAATAGAAGTTTTGGAAAAGAAATCCTAGGTGGAGTCTTGGCTTATACCCC[C/A]
GTTGAGCGCCTGTGAAGATGGAGCCGTAGGCCTGCTAGTCCACTGCTGTTTATTTTTGTTTGTCAAGCCTGAAGTGCCTTTGTAATAATATAAATATTAT

Reverse complement sequence

ATAATATTTATATTATTACAAAGGCACTTCAGGCTTGACAAACAAAAATAAACAGCAGTGGACTAGCAGGCCTACGGCTCCATCTTCACAGGCGCTCAAC[G/T]
GGGGTATAAGCCAAGACTCCACCTAGGATTTCTTTTCCAAAACTTCTATTACTAAAGGAGGGGGAAATATTGAGCAAGAATGAGTACAACCACTATACTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	31.70%	0.47%	2.12%	NA
All Indica	2759	97.80%	1.50%	0.07%	0.65%	NA
All Japonica	1512	4.80%	93.00%	1.12%	1.12%	NA
Aus	269	97.80%	1.10%	0.74%	0.37%	NA
Indica I	595	94.30%	2.90%	0.17%	2.69%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.20%	2.40%	0.13%	0.25%	NA
Temperate Japonica	767	5.90%	91.90%	2.09%	0.13%	NA
Tropical Japonica	504	4.20%	94.00%	0.20%	1.59%	NA
Japonica Intermediate	241	2.50%	94.20%	0.00%	3.32%	NA
VI/Aromatic	96	19.80%	17.70%	0.00%	62.50%	NA
Intermediate	90	62.20%	32.20%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109484212	C -> A	LOC_Os11g17090.1	upstream_gene_variant ; 2664.0bp to feature; MODIFIER	silent_mutation	Average:37.404; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg1109484212	C -> A	LOC_Os11g17080.1	downstream_gene_variant ; 4857.0bp to feature; MODIFIER	silent_mutation	Average:37.404; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg1109484212	C -> A	LOC_Os11g17080.3	downstream_gene_variant ; 4858.0bp to feature; MODIFIER	silent_mutation	Average:37.404; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg1109484212	C -> A	LOC_Os11g17080.2	downstream_gene_variant ; 4858.0bp to feature; MODIFIER	silent_mutation	Average:37.404; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg1109484212	C -> A	LOC_Os11g17090-LOC_Os11g17100	intergenic_region ; MODIFIER	silent_mutation	Average:37.404; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N
vg1109484212	C -> DEL	N	N	silent_mutation	Average:37.404; most accessible tissue: Zhenshan97 young leaf, score: 52.657	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109484212	NA	1.06E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109484212	1.14E-08	NA	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109484212	2.52E-06	NA	mr1842	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109484212	NA	2.93E-16	mr1968	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109484212	NA	3.35E-18	mr1336_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109484212	NA	4.48E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251