Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109262627:

Variant ID: vg1109262627 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 9262627
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GCGTGTTAGCTTGTCGTTTCCGTCGTTTCGAAGGTTCATGAGTGCGTTGGAAGTATCCAAGAAGAGTAATTGAAGACAGATTATTGCAAGGCAAGTCACA[C/T]
AGATCCCAAACACAATTCCTTTGAACATGTTGATCCTATATTTAAATTCTCTATTTATTTTAACTGTGCATTAATTTTCGAATGTCACCGGGTGGTGTGA

Reverse complement sequence

TCACACCACCCGGTGACATTCGAAAATTAATGCACAGTTAAAATAAATAGAGAATTTAAATATAGGATCAACATGTTCAAAGGAATTGTGTTTGGGATCT[G/A]
TGTGACTTGCCTTGCAATAATCTGTCTTCAATTACTCTTCTTGGATACTTCCAACGCACTCATGAACCTTCGAAACGACGGAAACGACAAGCTAACACGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	19.10%	0.78%	0.93%	NA
All Indica	2759	69.40%	27.70%	1.27%	1.59%	NA
All Japonica	1512	98.10%	1.90%	0.00%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	91.30%	8.10%	0.67%	0.00%	NA
Indica II	465	41.50%	53.10%	1.94%	3.44%	NA
Indica III	913	67.40%	29.20%	1.20%	2.19%	NA
Indica Intermediate	786	71.90%	25.70%	1.40%	1.02%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	96.60%	3.40%	0.00%	0.00%	NA
Japonica Intermediate	241	96.30%	3.70%	0.00%	0.00%	NA
VI/Aromatic	96	33.30%	66.70%	0.00%	0.00%	NA
Intermediate	90	68.90%	28.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1109262627	C -> T	LOC_Os11g16710.1	upstream_gene_variant ; 1233.0bp to feature; MODIFIER	silent_mutation	Average:19.265; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg1109262627	C -> T	LOC_Os11g16720.1	upstream_gene_variant ; 1710.0bp to feature; MODIFIER	silent_mutation	Average:19.265; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg1109262627	C -> T	LOC_Os11g16730.1	downstream_gene_variant ; 4016.0bp to feature; MODIFIER	silent_mutation	Average:19.265; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg1109262627	C -> T	LOC_Os11g16710-LOC_Os11g16720	intergenic_region ; MODIFIER	silent_mutation	Average:19.265; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N
vg1109262627	C -> DEL	N	N	silent_mutation	Average:19.265; most accessible tissue: Minghui63 flower, score: 33.997	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1109262627	NA	2.73E-06	mr1024	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109262627	NA	2.31E-06	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109262627	NA	7.94E-06	mr1135	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109262627	NA	1.84E-06	mr1149	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109262627	5.97E-06	5.97E-06	mr1159	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109262627	1.67E-06	3.24E-07	mr1504	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109262627	NA	4.21E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109262627	NA	1.89E-07	mr1837	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251