Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109260988:

Variant ID: vg1109260988 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9260988
Reference Allele: TAlternative Allele: G,A
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, T: 0.20, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GTCCATCGTCTCCTTCGGTCGCTGCCGCCACCGTTGGATTCGCAAGGAGGAGGAGAAGCCCGGCAGCCGGTTCCCTTGCGCCGAAATCTCGCCAGAAGCC[T/G,A]
TCCTCGCCGTGAACCAGTGGGTTGCCGCCGTCTTTTGATCTACAGCCGCCGTTCGCCGTCGTCCCGGCTGTCCCTGGTCTGAGCTGCTCCCTCCTTCGGC

Reverse complement sequence

GCCGAAGGAGGGAGCAGCTCAGACCAGGGACAGCCGGGACGACGGCGAACGGCGGCTGTAGATCAAAAGACGGCGGCAACCCACTGGTTCACGGCGAGGA[A/C,T]
GGCTTCTGGCGAGATTTCGGCGCAAGGGAACCGGCTGCCGGGCTTCTCCTCCTCCTTGCGAATCCAACGGTGGCGGCAGCGACCGAAGGAGACGATGGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.10% 21.00% 0.72% 36.12% A: 0.04%
All Indica  2759 8.40% 30.60% 1.12% 59.77% A: 0.07%
All Japonica  1512 95.60% 2.10% 0.00% 2.31% NA
Aus  269 91.10% 8.60% 0.00% 0.37% NA
Indica I  595 13.90% 8.90% 1.34% 75.80% NA
Indica II  465 2.20% 59.80% 1.08% 36.99% NA
Indica III  913 4.30% 31.50% 0.44% 63.75% NA
Indica Intermediate  786 12.70% 28.80% 1.78% 56.49% A: 0.25%
Temperate Japonica  767 97.00% 0.40% 0.00% 2.61% NA
Tropical Japonica  504 93.80% 3.80% 0.00% 2.38% NA
Japonica Intermediate  241 95.00% 3.70% 0.00% 1.24% NA
VI/Aromatic  96 30.20% 67.70% 0.00% 2.08% NA
Intermediate  90 43.30% 31.10% 3.33% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109260988 T -> DEL LOC_Os11g16710.1 N frameshift_variant Average:52.244; most accessible tissue: Minghui63 flag leaf, score: 92.36 N N N N
vg1109260988 T -> A LOC_Os11g16710.1 missense_variant ; p.Lys136Met; MODERATE nonsynonymous_codon ; K136M Average:52.244; most accessible tissue: Minghui63 flag leaf, score: 92.36 unknown unknown TOLERATED 0.13
vg1109260988 T -> G LOC_Os11g16710.1 missense_variant ; p.Lys136Thr; MODERATE nonsynonymous_codon ; K136T Average:52.244; most accessible tissue: Minghui63 flag leaf, score: 92.36 unknown unknown TOLERATED 0.99

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1109260988 T A 0.01 0.0 0.01 0.01 0.02 0.02
vg1109260988 T G 0.03 0.02 0.02 0.03 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109260988 NA 6.65E-06 mr1547 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109260988 NA 4.98E-06 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251