Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108676355:

Variant ID: vg1108676355 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8676355
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

GGAAGATCCACACCTCCCAAGGTGGGTAGCACCAGATCCCTTGGTCTTGTAGCCTCTGCCGCTCCCATTTGCCACCGCCATCGCTGCTCCCCACTATTGT[C/G]
GCTGAAGCTAGATTCGGACAACACACACCACTGTGCACATTGGCCGGATCCAATGAGGGGAGGGGAAGGAGGTTGTGCGCGGCAAGCTCAAGGAAGCAGT

Reverse complement sequence

ACTGCTTCCTTGAGCTTGCCGCGCACAACCTCCTTCCCCTCCCCTCATTGGATCCGGCCAATGTGCACAGTGGTGTGTGTTGTCCGAATCTAGCTTCAGC[G/C]
ACAATAGTGGGGAGCAGCGATGGCGGTGGCAAATGGGAGCGGCAGAGGCTACAAGACCAAGGGATCTGGTGCTACCCACCTTGGGAGGTGTGGATCTTCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	2.70%	1.71%	15.45%	NA
All Indica	2759	68.20%	4.50%	2.83%	24.43%	NA
All Japonica	1512	97.80%	0.00%	0.00%	2.18%	NA
Aus	269	97.80%	0.00%	0.00%	2.23%	NA
Indica I	595	92.40%	0.20%	1.51%	5.88%	NA
Indica II	465	35.90%	20.20%	7.31%	36.56%	NA
Indica III	913	68.70%	0.00%	1.20%	30.12%	NA
Indica Intermediate	786	68.60%	3.70%	3.05%	24.68%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.20%	0.00%	0.00%	1.79%	NA
Japonica Intermediate	241	90.00%	0.00%	0.00%	9.96%	NA
VI/Aromatic	96	92.70%	0.00%	0.00%	7.29%	NA
Intermediate	90	83.30%	2.20%	3.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108676355	C -> DEL	N	N	silent_mutation	Average:44.711; most accessible tissue: Zhenshan97 root, score: 95.177	N	N	N	N
vg1108676355	C -> G	LOC_Os11g15340.2	upstream_gene_variant ; 959.0bp to feature; MODIFIER	silent_mutation	Average:44.711; most accessible tissue: Zhenshan97 root, score: 95.177	N	N	N	N
vg1108676355	C -> G	LOC_Os11g15320-LOC_Os11g15340	intergenic_region ; MODIFIER	silent_mutation	Average:44.711; most accessible tissue: Zhenshan97 root, score: 95.177	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1108676355	C	G	0.0	0.03	0.02	0.01	0.01	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108676355	NA	6.13E-06	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	5.97E-06	mr1720	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	5.01E-06	mr1729	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	6.66E-06	mr1931	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	1.44E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	2.67E-10	mr1322_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	1.10E-06	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	1.08E-06	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	1.77E-07	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	1.77E-07	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	3.16E-06	mr1449_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	4.51E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108676355	NA	2.13E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251