Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108636902:

Variant ID: vg1108636902 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8636902
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGGCGTCGGTCGCTGGGGCTCGAGCTTGTCGCGATGGAGGAGATGGCAAGGACGGCGGGAGTGGCCACCGTGGCGCTCGCGGCAAGAGAGATCAAGGA[C/T]
GGCGGGAGCGGCGGAGGACGGCTAGGACGTGGCGAATCGACACGCAGCAGGAGCGGCGGAGGACAGCGAGGACGCTATTGGCGCGATGTCCATTGGCAAA

Reverse complement sequence

TTTGCCAATGGACATCGCGCCAATAGCGTCCTCGCTGTCCTCCGCCGCTCCTGCTGCGTGTCGATTCGCCACGTCCTAGCCGTCCTCCGCCGCTCCCGCC[G/A]
TCCTTGATCTCTCTTGCCGCGAGCGCCACGGTGGCCACTCCCGCCGTCCTTGCCATCTCCTCCATCGCGACAAGCTCGAGCCCCAGCGACCGACGCCGCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.60%	4.00%	0.19%	0.17%	NA
All Indica	2759	93.00%	6.80%	0.22%	0.00%	NA
All Japonica	1512	99.20%	0.10%	0.20%	0.53%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	97.50%	2.40%	0.17%	0.00%	NA
Indica II	465	88.40%	11.40%	0.22%	0.00%	NA
Indica III	913	93.30%	6.60%	0.11%	0.00%	NA
Indica Intermediate	786	92.00%	7.60%	0.38%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.20%	0.00%	0.20%	NA
Japonica Intermediate	241	95.90%	0.00%	1.24%	2.90%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108636902	C -> T	LOC_Os11g15280.1	upstream_gene_variant ; 1697.0bp to feature; MODIFIER	silent_mutation	Average:46.175; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1108636902	C -> T	LOC_Os11g15290.1	downstream_gene_variant ; 859.0bp to feature; MODIFIER	silent_mutation	Average:46.175; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1108636902	C -> T	LOC_Os11g15280-LOC_Os11g15290	intergenic_region ; MODIFIER	silent_mutation	Average:46.175; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg1108636902	C -> DEL	N	N	silent_mutation	Average:46.175; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108636902	5.02E-06	2.36E-07	mr1324	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108636902	NA	1.34E-06	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108636902	NA	3.11E-06	mr1326	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108636902	1.60E-06	7.56E-08	mr1335	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108636902	NA	1.41E-06	mr1346	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108636902	3.29E-06	3.29E-06	mr1540	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108636902	6.63E-06	NA	mr1630	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108636902	8.98E-06	1.79E-06	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251