Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108505992:

Variant ID: vg1108505992 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8505992
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTTTGGAAGTGTGGCTTGGTCATCAATCTTGTTGGAACACATCAAGGCATAGTGTCCCACTTTCTTGCACATGAAGCTAGTAATGGGAGTTTTGATCC[A/T]
ACTTTGAATTTGTCTCTTATTCATGTTGTTTTCTTCATAGGACTTGGTGCAAGCTAAATTTGATCCCTTCTCAAGCTTCTTCTCCATGTTCCCACGGTTA

Reverse complement sequence

TAACCGTGGGAACATGGAGAAGAAGCTTGAGAAGGGATCAAATTTAGCTTGCACCAAGTCCTATGAAGAAAACAACATGAATAAGAGACAAATTCAAAGT[T/A]
GGATCAAAACTCCCATTACTAGCTTCATGTGCAAGAAAGTGGGACACTATGCCTTGATGTGTTCCAACAAGATTGATGACCAAGCCACACTTCCAAAGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	38.90%	29.90%	10.03%	21.22%	NA
All Indica	2759	5.30%	48.50%	16.42%	29.72%	NA
All Japonica	1512	89.90%	3.40%	0.46%	6.15%	NA
Aus	269	73.60%	1.50%	1.49%	23.42%	NA
Indica I	595	8.10%	36.50%	20.34%	35.13%	NA
Indica II	465	1.70%	46.20%	19.57%	32.47%	NA
Indica III	913	2.10%	62.10%	10.62%	25.19%	NA
Indica Intermediate	786	9.20%	43.30%	18.32%	29.26%	NA
Temperate Japonica	767	97.90%	0.70%	0.26%	1.17%	NA
Tropical Japonica	504	80.20%	8.70%	0.79%	10.32%	NA
Japonica Intermediate	241	85.10%	1.20%	0.41%	13.28%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	43.30%	16.70%	11.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108505992	A -> T	LOC_Os11g15100.1	upstream_gene_variant ; 4370.0bp to feature; MODIFIER	silent_mutation	Average:9.888; most accessible tissue: Callus, score: 45.277	N	N	N	N
vg1108505992	A -> T	LOC_Os11g15110.1	downstream_gene_variant ; 54.0bp to feature; MODIFIER	silent_mutation	Average:9.888; most accessible tissue: Callus, score: 45.277	N	N	N	N
vg1108505992	A -> T	LOC_Os11g15100-LOC_Os11g15110	intergenic_region ; MODIFIER	silent_mutation	Average:9.888; most accessible tissue: Callus, score: 45.277	N	N	N	N
vg1108505992	A -> DEL	N	N	silent_mutation	Average:9.888; most accessible tissue: Callus, score: 45.277	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108505992	NA	9.47E-15	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	4.50E-07	mr1538	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	3.18E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	3.85E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	6.89E-10	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	6.57E-10	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	2.75E-21	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	2.64E-09	mr1504_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	8.46E-11	mr1538_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	5.77E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108505992	NA	7.51E-26	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251