Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108341737:

Variant ID: vg1108341737 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8341737
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCGTGGCGCAGTTGTCTATTCAACAACAGAAATAATGAAAATTTCAGAATTAAAAATAAATAATATTAGAAGAAGAGACTAGAGTATATATAGAAATA[C/A]
AATTTACAGATAACGAAAATTTGGAATTAAAAAATATTGAAAGACGAGTCTAGAGTCCATATAGGAATATAATTTACAAATAACTAAAAGCTGATATTAA

Reverse complement sequence

TTAATATCAGCTTTTAGTTATTTGTAAATTATATTCCTATATGGACTCTAGACTCGTCTTTCAATATTTTTTAATTCCAAATTTTCGTTATCTGTAAATT[G/T]
TATTTCTATATATACTCTAGTCTCTTCTTCTAATATTATTTATTTTTAATTCTGAAATTTTCATTATTTCTGTTGTTGAATAGACAACTGCGCCACGCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.60%	37.70%	9.78%	10.90%	NA
All Indica	2759	6.50%	59.80%	16.13%	17.58%	NA
All Japonica	1512	96.00%	2.40%	0.73%	0.86%	NA
Aus	269	72.90%	27.10%	0.00%	0.00%	NA
Indica I	595	12.10%	37.60%	24.71%	25.55%	NA
Indica II	465	2.60%	53.10%	19.14%	25.16%	NA
Indica III	913	1.20%	79.30%	10.95%	8.54%	NA
Indica Intermediate	786	10.70%	57.90%	13.87%	17.56%	NA
Temperate Japonica	767	98.00%	0.30%	0.39%	1.30%	NA
Tropical Japonica	504	95.60%	2.80%	1.19%	0.40%	NA
Japonica Intermediate	241	90.50%	8.30%	0.83%	0.41%	NA
VI/Aromatic	96	97.90%	1.00%	0.00%	1.04%	NA
Intermediate	90	50.00%	25.60%	6.67%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108341737	C -> A	LOC_Os11g14830.1	upstream_gene_variant ; 3554.0bp to feature; MODIFIER	silent_mutation	Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1108341737	C -> A	LOC_Os11g14810.1	downstream_gene_variant ; 4397.0bp to feature; MODIFIER	silent_mutation	Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1108341737	C -> A	LOC_Os11g14820.1	downstream_gene_variant ; 1366.0bp to feature; MODIFIER	silent_mutation	Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1108341737	C -> A	LOC_Os11g14810-LOC_Os11g14820	intergenic_region ; MODIFIER	silent_mutation	Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N
vg1108341737	C -> DEL	N	N	silent_mutation	Average:19.833; most accessible tissue: Zhenshan97 panicle, score: 32.308	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108341737	NA	1.12E-06	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737	NA	2.50E-59	mr1088	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737	NA	1.62E-32	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737	NA	7.03E-16	mr1199	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737	NA	4.78E-31	mr1224	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737	NA	9.64E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737	1.60E-06	1.95E-08	mr1763	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108341737	NA	4.62E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251