Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108160327:

Variant ID: vg1108160327 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 8160327
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGCATAATGGCTTAATGCGGATGTCAGTGTGTGCGGCGATGCGTGGGGATGGGAACGGGGTGGATGCGTGAGGGAGAGGCGCGATCGGGTGGAAGAAGC[G/A]
CGGATGCCGTCAAATGCAAACTCATCAGATCATTGTCGATCGTCGGATGTGTCATACGATGAATGAGTGAACCACTTATTTAACTATAGGGTAGATGATG

Reverse complement sequence

CATCATCTACCCTATAGTTAAATAAGTGGTTCACTCATTCATCGTATGACACATCCGACGATCGACAATGATCTGATGAGTTTGCATTTGACGGCATCCG[C/T]
GCTTCTTCCACCCGATCGCGCCTCTCCCTCACGCATCCACCCCGTTCCCATCCCCACGCATCGCCGCACACACTGACATCCGCATTAAGCCATTATGCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	39.40%	0.51%	0.49%	NA
All Indica	2759	94.40%	4.10%	0.65%	0.83%	NA
All Japonica	1512	5.20%	94.60%	0.26%	0.00%	NA
Aus	269	27.90%	72.10%	0.00%	0.00%	NA
Indica I	595	92.30%	6.40%	1.01%	0.34%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	95.90%	1.20%	0.77%	2.08%	NA
Indica Intermediate	786	91.50%	7.80%	0.51%	0.25%	NA
Temperate Japonica	767	1.80%	98.00%	0.13%	0.00%	NA
Tropical Japonica	504	6.50%	93.10%	0.40%	0.00%	NA
Japonica Intermediate	241	12.90%	86.70%	0.41%	0.00%	NA
VI/Aromatic	96	10.40%	89.60%	0.00%	0.00%	NA
Intermediate	90	54.40%	43.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1108160327	G -> A	LOC_Os11g14520.1	upstream_gene_variant ; 2072.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14525.1	upstream_gene_variant ; 854.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14530.1	upstream_gene_variant ; 658.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14544.1	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14544.6	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14544.4	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14544.2	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14544.3	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14544.5	downstream_gene_variant ; 3025.0bp to feature; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> A	LOC_Os11g14525-LOC_Os11g14530	intergenic_region ; MODIFIER	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N
vg1108160327	G -> DEL	N	N	silent_mutation	Average:57.188; most accessible tissue: Zhenshan97 root, score: 68.908	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1108160327	NA	1.11E-22	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108160327	5.27E-07	2.47E-08	mr1350_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108160327	NA	2.10E-21	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251