Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1108085174:

Variant ID: vg1108085174 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 8085174
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACGGAAGCTAGTCAACCGTCTCTGACAAAAGTCAACCAACATTTTGATCTCTACTCGGTTAGACAGCTCGGTGGATCGACGTCCCCAAACGCCACCCC[G/A]
TGCGCGTTCCGGCAGAACGACGCCGCCGGCTGCTCCTCCTCCGCCGCCGCCGCCGGTGGCTGGTACCTCAGCCGGACGTCCCTCATGGCGATCCCGGCGC

Reverse complement sequence

GCGCCGGGATCGCCATGAGGGACGTCCGGCTGAGGTACCAGCCACCGGCGGCGGCGGCGGAGGAGGAGCAGCCGGCGGCGTCGTTCTGCCGGAACGCGCA[C/T]
GGGGTGGCGTTTGGGGACGTCGATCCACCGAGCTGTCTAACCGAGTAGAGATCAAAATGTTGGTTGACTTTTGTCAGAGACGGTTGACTAGCTTCCGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 9.00% 0.02% 0.00% NA
All Indica  2759 87.80% 12.20% 0.04% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 88.10% 11.90% 0.00% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 84.10% 15.90% 0.00% 0.00% NA
Indica Intermediate  786 85.80% 14.20% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 97.20% 2.80% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1108085174 G -> A LOC_Os11g14400.1 3_prime_UTR_variant ; 228.0bp to feature; MODIFIER silent_mutation Average:89.53; most accessible tissue: Callus, score: 93.154 N N N N
vg1108085174 G -> A LOC_Os11g14390.1 upstream_gene_variant ; 349.0bp to feature; MODIFIER silent_mutation Average:89.53; most accessible tissue: Callus, score: 93.154 N N N N
vg1108085174 G -> A LOC_Os11g14410.1 downstream_gene_variant ; 4973.0bp to feature; MODIFIER silent_mutation Average:89.53; most accessible tissue: Callus, score: 93.154 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1108085174 G A 0.0 -0.04 -0.04 -0.03 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1108085174 NA 5.81E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108085174 NA 1.36E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108085174 NA 1.42E-06 mr1185 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108085174 NA 2.18E-06 mr1185 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1108085174 1.24E-06 1.09E-09 mr1705 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251