Variant ID: vg1107947407 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 7947407 |
Reference Allele: A | Alternative Allele: C |
Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 254. )
GACGCAATAGTTCAAGGGCGGTAATTCGTACGTTTTCCTTTTGGATGAATATGACACTTCCTAGTACAATGAATTTGGACATACGGTCACATCCACCCAA[A/C]
ATCCCTTATATTATAGGACGAAGGGAATATCAGACGTTCGCTTCCACTCCTAAAACCCTGCCCGCACCTCACACCATCTTCATGGTGTCTGAGTTGCACC
GGTGCAACTCAGACACCATGAAGATGGTGTGAGGTGCGGGCAGGGTTTTAGGAGTGGAAGCGAACGTCTGATATTCCCTTCGTCCTATAATATAAGGGAT[T/G]
TTGGGTGGATGTGACCGTATGTCCAAATTCATTGTACTAGGAAGTGTCATATTCATCCAAAAGGAAAACGTACGAATTACCGCCCTTGAACTATTGCGTC
Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 85.10% | 14.90% | 0.06% | 0.00% | NA |
All Indica | 2759 | 75.90% | 24.10% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
Indica I | 595 | 88.40% | 11.30% | 0.34% | 0.00% | NA |
Indica II | 465 | 76.60% | 23.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 66.30% | 33.70% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1107947407 | A -> C | LOC_Os11g14200.1 | downstream_gene_variant ; 583.0bp to feature; MODIFIER | silent_mutation | Average:53.572; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
vg1107947407 | A -> C | LOC_Os11g14200-LOC_Os11g14210 | intergenic_region ; MODIFIER | silent_mutation | Average:53.572; most accessible tissue: Zhenshan97 young leaf, score: 76.099 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1107947407 | NA | 9.74E-07 | mr1498 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107947407 | 4.63E-06 | 4.63E-06 | mr1640 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107947407 | NA | 9.49E-07 | mr1729 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107947407 | NA | 9.86E-07 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107947407 | NA | 3.71E-13 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107947407 | NA | 5.42E-11 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107947407 | NA | 5.88E-06 | mr1956 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1107947407 | NA | 7.94E-06 | mr1956 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |