Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106569715:

Variant ID: vg1106569715 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 6569715
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.10, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

CAAATAGACTGCCGTATTTACTGCCTCTCCCCAGAACATACCTGGGAGCCCTTTTGCCTTTAACATGCTCCTCGTCGTGCCCACCACCGATTGATTCCGG[T/C]
GCTCGACGACGCCGTTCTGCTGTGGCGAATACGGCGCCGTGAGTTCTCGACGCAGTCCGAGCTCGGCGCAGTACTCGTTGAAGTGGCTGTTGACGGTCGT

Reverse complement sequence

ACGACCGTCAACAGCCACTTCAACGAGTACTGCGCCGAGCTCGGACTGCGTCGAGAACTCACGGCGCCGTATTCGCCACAGCAGAACGGCGTCGTCGAGC[A/G]
CCGGAATCAATCGGTGGTGGGCACGACGAGGAGCATGTTAAAGGCAAAAGGGCTCCCAGGTATGTTCTGGGGAGAGGCAGTAAATACGGCAGTCTATTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.70%	20.10%	1.23%	41.96%	NA
All Indica	2759	36.20%	6.80%	1.67%	55.35%	NA
All Japonica	1512	28.80%	47.00%	0.60%	23.54%	NA
Aus	269	74.30%	3.00%	0.00%	22.68%	NA
Indica I	595	21.00%	13.30%	1.85%	63.87%	NA
Indica II	465	23.20%	8.40%	1.94%	66.45%	NA
Indica III	913	52.70%	2.20%	1.97%	43.15%	NA
Indica Intermediate	786	36.10%	6.40%	1.02%	56.49%	NA
Temperate Japonica	767	23.70%	50.70%	1.04%	24.51%	NA
Tropical Japonica	504	38.50%	40.10%	0.00%	21.43%	NA
Japonica Intermediate	241	24.90%	49.80%	0.41%	24.90%	NA
VI/Aromatic	96	67.70%	19.80%	0.00%	12.50%	NA
Intermediate	90	38.90%	27.80%	3.33%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1106569715	T -> DEL	N	N	silent_mutation	Average:10.082; most accessible tissue: Callus, score: 31.479	N	N	N	N
vg1106569715	T -> C	LOC_Os11g11820.1	upstream_gene_variant ; 3626.0bp to feature; MODIFIER	silent_mutation	Average:10.082; most accessible tissue: Callus, score: 31.479	N	N	N	N
vg1106569715	T -> C	LOC_Os11g11830.1	upstream_gene_variant ; 221.0bp to feature; MODIFIER	silent_mutation	Average:10.082; most accessible tissue: Callus, score: 31.479	N	N	N	N
vg1106569715	T -> C	LOC_Os11g11840.1	upstream_gene_variant ; 2207.0bp to feature; MODIFIER	silent_mutation	Average:10.082; most accessible tissue: Callus, score: 31.479	N	N	N	N
vg1106569715	T -> C	LOC_Os11g11850.1	upstream_gene_variant ; 4568.0bp to feature; MODIFIER	silent_mutation	Average:10.082; most accessible tissue: Callus, score: 31.479	N	N	N	N
vg1106569715	T -> C	LOC_Os11g11830-LOC_Os11g11840	intergenic_region ; MODIFIER	silent_mutation	Average:10.082; most accessible tissue: Callus, score: 31.479	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1106569715	2.01E-06	7.65E-06	mr1685	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106569715	6.75E-06	9.88E-06	mr1977	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251