Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1106552685:

Variant ID: vg1106552685 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 6552685
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.16, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:

CACTTGAAGATGAAATGATGAGTTGGAATGTTGCCTCTCTACATATCTTTGTGTTTCCACTTTTTCAGACATTATGCAACCCCTCTAGACTACGCTTATA[A/G]
CATAAGGGTTGCATAACACGTTCTCACTACGACATTCTACCGAAGACCGAGAGAGAATAACTTTGTGTCTCTACTTTTTCAGATATTATGCAACCCCTAT

Reverse complement sequence

ATAGGGGTTGCATAATATCTGAAAAAGTAGAGACACAAAGTTATTCTCTCTCGGTCTTCGGTAGAATGTCGTAGTGAGAACGTGTTATGCAACCCTTATG[T/C]
TATAAGCGTAGTCTAGAGGGGTTGCATAATGTCTGAAAAAGTGGAAACACAAAGATATGTAGAGAGGCAACATTCCAACTCATCATTTCATCTTCAAGTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.10%	17.60%	0.47%	45.90%	NA
All Indica	2759	35.50%	3.40%	0.40%	60.75%	NA
All Japonica	1512	28.50%	45.30%	0.60%	25.60%	NA
Aus	269	73.20%	3.30%	0.37%	23.05%	NA
Indica I	595	20.70%	6.70%	0.34%	72.27%	NA
Indica II	465	23.00%	3.00%	0.43%	73.55%	NA
Indica III	913	52.10%	0.80%	0.33%	46.77%	NA
Indica Intermediate	786	34.70%	4.10%	0.51%	60.69%	NA
Temperate Japonica	767	23.60%	48.50%	0.65%	27.25%	NA
Tropical Japonica	504	37.90%	39.10%	0.40%	22.62%	NA
Japonica Intermediate	241	24.50%	48.10%	0.83%	26.56%	NA
VI/Aromatic	96	66.70%	20.80%	0.00%	12.50%	NA
Intermediate	90	37.80%	25.60%	1.11%	35.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1106552685	A -> DEL	N	N	silent_mutation	Average:18.525; most accessible tissue: Callus, score: 78.785	N	N	N	N
vg1106552685	A -> G	LOC_Os11g11800.1	upstream_gene_variant ; 3344.0bp to feature; MODIFIER	silent_mutation	Average:18.525; most accessible tissue: Callus, score: 78.785	N	N	N	N
vg1106552685	A -> G	LOC_Os11g11810.1	upstream_gene_variant ; 1829.0bp to feature; MODIFIER	silent_mutation	Average:18.525; most accessible tissue: Callus, score: 78.785	N	N	N	N
vg1106552685	A -> G	LOC_Os11g11800-LOC_Os11g11810	intergenic_region ; MODIFIER	silent_mutation	Average:18.525; most accessible tissue: Callus, score: 78.785	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1106552685	NA	1.38E-07	mr1030_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	6.94E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	2.40E-07	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	9.44E-06	mr1284_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	5.78E-06	5.77E-06	mr1286_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	5.41E-06	5.41E-06	mr1311_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	6.16E-08	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	5.82E-06	3.61E-07	mr1337_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	2.41E-06	1.29E-08	mr1524_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	4.86E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	1.75E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	1.09E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	9.54E-06	9.50E-06	mr1760_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	6.32E-06	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	NA	6.65E-07	mr1965_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1106552685	2.09E-06	1.65E-08	mr1982_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251