Variant ID: vg1106187045 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 6187045 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTCTATCCATGTGCGGTAATCATCTCGAAGCACCTCAATTCAACCCGATGTCATACACCAAGTTGTATTGTCGGAATCGGCTGCATCAGCCCACCTAGTC[C/T]
GACTCAGACTCAGCCGATCCTAATCGTAGTCGATCTGGACTCTAGCCGATTCCTGCTTTGTTCCTGAATCGATCTCCGCCTTCAACTCCACTTCGATCTA
TAGATCGAAGTGGAGTTGAAGGCGGAGATCGATTCAGGAACAAAGCAGGAATCGGCTAGAGTCCAGATCGACTACGATTAGGATCGGCTGAGTCTGAGTC[G/A]
GACTAGGTGGGCTGATGCAGCCGATTCCGACAATACAACTTGGTGTATGACATCGGGTTGAATTGAGGTGCTTCGAGATGATTACCGCACATGGATAGAG
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 95.60% | 4.40% | 0.02% | 0.00% | NA |
All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 32.30% | 67.30% | 0.37% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1106187045 | C -> T | LOC_Os11g11170.1 | upstream_gene_variant ; 3614.0bp to feature; MODIFIER | silent_mutation | Average:26.725; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
vg1106187045 | C -> T | LOC_Os11g11180.1 | downstream_gene_variant ; 3145.0bp to feature; MODIFIER | silent_mutation | Average:26.725; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
vg1106187045 | C -> T | LOC_Os11g11170-LOC_Os11g11180 | intergenic_region ; MODIFIER | silent_mutation | Average:26.725; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1106187045 | 1.61E-07 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 5.99E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 1.29E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 3.65E-09 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 5.40E-06 | mr1349 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 3.97E-09 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 6.78E-07 | mr1556 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 2.12E-09 | mr1669 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 1.08E-10 | mr1696 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 1.16E-06 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 8.85E-06 | mr1738 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1106187045 | NA | 7.87E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |