| Variant ID: vg1105544663 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 5544663 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 123. )
AGTTAGACTAGAGTGAATTAATAAGGATTACCACAGGTCGGGTCGCACACTCGCACCCATCCCACAACAACAATTTCATCCAAGTGCCTACAGCCGCACG[G/A]
CCAGAAACACACACCGAATAATACACAGCAGGAAAATGTCACCGGAGATTGCAGCCAACTGATAAATCCAAACTGCATCAGATTTCGAGTTCTTTAGCAT
ATGCTAAAGAACTCGAAATCTGATGCAGTTTGGATTTATCAGTTGGCTGCAATCTCCGGTGACATTTTCCTGCTGTGTATTATTCGGTGTGTGTTTCTGG[C/T]
CGTGCGGCTGTAGGCACTTGGATGAAATTGTTGTTGTGGGATGGGTGCGAGTGTGCGACCCGACCTGTGGTAATCCTTATTAATTCACTCTAGTCTAACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 48.30% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 73.10% | 26.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 6.50% | 93.10% | 0.40% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 73.60% | 26.20% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.60% | 26.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 63.10% | 36.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 12.30% | 86.70% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 92.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1105544663 | G -> A | LOC_Os11g10210.1 | downstream_gene_variant ; 3641.0bp to feature; MODIFIER | silent_mutation | Average:74.134; most accessible tissue: Minghui63 flower, score: 82.507 | N | N | N | N |
| vg1105544663 | G -> A | LOC_Os11g10220.1 | downstream_gene_variant ; 2173.0bp to feature; MODIFIER | silent_mutation | Average:74.134; most accessible tissue: Minghui63 flower, score: 82.507 | N | N | N | N |
| vg1105544663 | G -> A | LOC_Os11g10210-LOC_Os11g10220 | intergenic_region ; MODIFIER | silent_mutation | Average:74.134; most accessible tissue: Minghui63 flower, score: 82.507 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1105544663 | NA | 2.06E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105544663 | 3.83E-06 | 3.83E-06 | mr1375 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105544663 | NA | 5.97E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105544663 | NA | 1.61E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105544663 | NA | 5.16E-07 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1105544663 | 4.91E-06 | 5.86E-06 | mr1931 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |