Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105407599:

Variant ID: vg1105407599 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5407599
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.01, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

GATAGAACATTACAAGTTCGACAACACGGCTGCTCTCATTGGCCTCATTGCTTATGAAGCATCAGTAAGAGTGCCAACACCTCGAACTGTGTCAAAGCAT[T/A]
TGGCCTTTGCAATAATGCTGTCATGGAAAAAGGTCATTCGCGACAGCAAGCATCTGAGCCTGTCAACTGTATGTTGTAATTGTTCGTTTAGCTGCTTGTG

Reverse complement sequence

CACAAGCAGCTAAACGAACAATTACAACATACAGTTGACAGGCTCAGATGCTTGCTGTCGCGAATGACCTTTTTCCATGACAGCATTATTGCAAAGGCCA[A/T]
ATGCTTTGACACAGTTCGAGGTGTTGGCACTCTTACTGATGCTTCATAAGCAATGAGGCCAATGAGAGCAGCCGTGTTGTCGAACTTGTAATGTTCTATC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.40%	28.50%	0.08%	0.00%	NA
All Indica	2759	96.20%	3.80%	0.04%	0.00%	NA
All Japonica	1512	25.80%	74.10%	0.13%	0.00%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	97.00%	3.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	98.20%	1.60%	0.11%	0.00%	NA
Indica Intermediate	786	91.50%	8.50%	0.00%	0.00%	NA
Temperate Japonica	767	28.80%	71.10%	0.13%	0.00%	NA
Tropical Japonica	504	27.40%	72.60%	0.00%	0.00%	NA
Japonica Intermediate	241	12.90%	86.70%	0.41%	0.00%	NA
VI/Aromatic	96	20.80%	79.20%	0.00%	0.00%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105407599	T -> A	LOC_Os11g10060.1	downstream_gene_variant ; 102.0bp to feature; MODIFIER	silent_mutation	Average:71.964; most accessible tissue: Minghui63 flower, score: 86.025	N	N	N	N
vg1105407599	T -> A	LOC_Os11g10060-LOC_Os11g10070	intergenic_region ; MODIFIER	silent_mutation	Average:71.964; most accessible tissue: Minghui63 flower, score: 86.025	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1105407599	T	A	0.03	0.03	0.03	0.03	0.03	0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105407599	NA	1.02E-06	mr1278	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	1.68E-12	mr1521	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	6.82E-06	NA	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	9.44E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	4.04E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	9.02E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	2.96E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	2.23E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	5.54E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	5.47E-07	NA	mr1624_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	2.90E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	3.08E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105407599	NA	5.54E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251