Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1105286830:

Variant ID: vg1105286830 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 5286830
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, T: 0.11, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ATTAAGGGCAAAGGGGACTTTTTCTAATAGAATTGTTGACTAGAAATAGCCATATGGCATATTAAGTGGGCCCAAGGATGATTTTAAGCCAAAACAAATA[C/T]
TTAGAGGACCTATGTGGACAAAGTAAAACCTGAAGGACTAAATTGAGACTTCAGTGAAACTTGAGGGACTAAATTAGCTATTTAACAAAAAAAACATAAG

Reverse complement sequence

CTTATGTTTTTTTTGTTAAATAGCTAATTTAGTCCCTCAAGTTTCACTGAAGTCTCAATTTAGTCCTTCAGGTTTTACTTTGTCCACATAGGTCCTCTAA[G/A]
TATTTGTTTTGGCTTAAAATCATCCTTGGGCCCACTTAATATGCCATATGGCTATTTCTAGTCAACAATTCTATTAGAAAAAGTCCCCTTTGCCCTTAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.30%	19.90%	0.49%	55.31%	NA
All Indica	2759	8.90%	25.90%	0.36%	64.84%	NA
All Japonica	1512	58.40%	10.70%	0.33%	30.56%	NA
Aus	269	0.00%	5.90%	0.37%	93.68%	NA
Indica I	595	4.70%	19.00%	0.50%	75.80%	NA
Indica II	465	3.90%	9.90%	0.43%	85.81%	NA
Indica III	913	7.20%	40.40%	0.22%	52.14%	NA
Indica Intermediate	786	16.90%	23.80%	0.38%	58.91%	NA
Temperate Japonica	767	60.60%	17.60%	0.00%	21.77%	NA
Tropical Japonica	504	65.50%	3.40%	0.40%	30.75%	NA
Japonica Intermediate	241	36.50%	4.10%	1.24%	58.09%	NA
VI/Aromatic	96	3.10%	26.00%	5.21%	65.62%	NA
Intermediate	90	20.00%	24.40%	2.22%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1105286830	C -> T	LOC_Os11g09870.1	upstream_gene_variant ; 1693.0bp to feature; MODIFIER	silent_mutation	Average:8.945; most accessible tissue: Callus, score: 35.016	N	N	N	N
vg1105286830	C -> T	LOC_Os11g09864.1	downstream_gene_variant ; 2130.0bp to feature; MODIFIER	silent_mutation	Average:8.945; most accessible tissue: Callus, score: 35.016	N	N	N	N
vg1105286830	C -> T	LOC_Os11g09880.1	downstream_gene_variant ; 3108.0bp to feature; MODIFIER	silent_mutation	Average:8.945; most accessible tissue: Callus, score: 35.016	N	N	N	N
vg1105286830	C -> T	LOC_Os11g09890.1	downstream_gene_variant ; 4411.0bp to feature; MODIFIER	silent_mutation	Average:8.945; most accessible tissue: Callus, score: 35.016	N	N	N	N
vg1105286830	C -> T	LOC_Os11g09864.2	downstream_gene_variant ; 2130.0bp to feature; MODIFIER	silent_mutation	Average:8.945; most accessible tissue: Callus, score: 35.016	N	N	N	N
vg1105286830	C -> T	LOC_Os11g09870-LOC_Os11g09880	intergenic_region ; MODIFIER	silent_mutation	Average:8.945; most accessible tissue: Callus, score: 35.016	N	N	N	N
vg1105286830	C -> DEL	N	N	silent_mutation	Average:8.945; most accessible tissue: Callus, score: 35.016	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1105286830	NA	1.36E-12	mr1097_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	1.59E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	2.81E-06	2.81E-06	mr1153_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	5.26E-06	NA	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	9.12E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	7.92E-06	7.92E-06	mr1262_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	5.51E-08	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	5.53E-06	mr1351_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	5.28E-06	5.28E-06	mr1353_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	3.13E-06	mr1381_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	3.77E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	5.03E-06	mr1574_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	1.15E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	1.68E-10	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	4.97E-06	4.97E-07	mr1646_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	1.80E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	3.08E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	6.16E-09	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	2.61E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	8.93E-06	mr1702_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	3.55E-06	NA	mr1713_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	9.75E-08	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	7.39E-10	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	1.72E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1105286830	NA	1.77E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251