Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104609253:

Variant ID: vg1104609253 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4609253
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, T: 0.01, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

CCACTGGCCCTATCAGGCAATATAATGGAGTCCTCCAGGGGTTGATGTTTAACGTGATGGCCTTCAACGTTGAATCATTCACAAGCGAAACATCATATTT[A/G]
CAAATTAAAAATAATTTATGAATAAAACTTTTATATACATGTTCTTAGCGATTTAAAACCATAAGGCTGAAAAATGTACTTCAATAAAAAGAAAAGCTCA

Reverse complement sequence

TGAGCTTTTCTTTTTATTGAAGTACATTTTTCAGCCTTATGGTTTTAAATCGCTAAGAACATGTATATAAAAGTTTTATTCATAAATTATTTTTAATTTG[T/C]
AAATATGATGTTTCGCTTGTGAATGATTCAACGTTGAAGGCCATCACGTTAAACATCAACCCCTGGAGGACTCCATTATATTGCCTGATAGGGCCAGTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.60%	28.40%	0.06%	0.00%	NA
All Indica	2759	53.00%	46.90%	0.11%	0.00%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	45.20%	54.60%	0.17%	0.00%	NA
Indica II	465	81.50%	18.50%	0.00%	0.00%	NA
Indica III	913	48.10%	51.90%	0.00%	0.00%	NA
Indica Intermediate	786	47.70%	52.00%	0.25%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104609253	A -> G	LOC_Os11g08660.1	upstream_gene_variant ; 4903.0bp to feature; MODIFIER	silent_mutation	Average:56.536; most accessible tissue: Callus, score: 91.421	N	N	N	N
vg1104609253	A -> G	LOC_Os11g08650.1	downstream_gene_variant ; 2771.0bp to feature; MODIFIER	silent_mutation	Average:56.536; most accessible tissue: Callus, score: 91.421	N	N	N	N
vg1104609253	A -> G	LOC_Os11g08640-LOC_Os11g08650	intergenic_region ; MODIFIER	silent_mutation	Average:56.536; most accessible tissue: Callus, score: 91.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104609253	NA	5.38E-06	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	1.40E-06	mr1090	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	1.53E-06	mr1094	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	2.37E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	4.61E-06	mr1228	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	5.47E-06	5.47E-06	mr1337	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	4.43E-06	mr1354	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	1.65E-08	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	1.22E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	3.80E-06	mr1518	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	5.76E-06	5.76E-06	mr1524	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	7.07E-07	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	4.30E-06	4.77E-08	mr1549	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	7.60E-06	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	1.94E-06	mr1728	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	4.49E-11	mr1860	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	7.93E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104609253	NA	7.46E-07	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251