Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104300143:

Variant ID: vg1104300143 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4300143
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.60, G: 0.40, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


CGTCACGTTCCGTTAATTAGAACGGCTTCTGCAGGTACGTGAACATGTCGCCGAAGGCGGCGCCGTCGCCGGCGGCGCGGGAGAACGCCGCCGGCGAGGG[C/G]
AGCTCGAAGAGGGAGCTGTCGATGACGAAGCCATCGTCGCCGACGGCGGCCCAGTCGACGCCGGGCCACCCGCCGCATCCGCCGCTGGGCTGGCTCTCGG

Reverse complement sequence

CCGAGAGCCAGCCCAGCGGCGGATGCGGCGGGTGGCCCGGCGTCGACTGGGCCGCCGTCGGCGACGATGGCTTCGTCATCGACAGCTCCCTCTTCGAGCT[G/C]
CCCTCGCCGGCGGCGTTCTCCCGCGCCGCCGGCGACGGCGCCGCCTTCGGCGACATGTTCACGTACCTGCAGAAGCCGTTCTAATTAACGGAACGTGACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 47.70% 0.25% 0.00% NA
All Indica  2759 45.10% 54.60% 0.29% 0.00% NA
All Japonica  1512 67.40% 32.30% 0.26% 0.00% NA
Aus  269 57.20% 42.80% 0.00% 0.00% NA
Indica I  595 91.90% 7.90% 0.17% 0.00% NA
Indica II  465 11.60% 87.70% 0.65% 0.00% NA
Indica III  913 42.30% 57.50% 0.22% 0.00% NA
Indica Intermediate  786 32.70% 67.00% 0.25% 0.00% NA
Temperate Japonica  767 96.50% 3.40% 0.13% 0.00% NA
Tropical Japonica  504 19.00% 80.80% 0.20% 0.00% NA
Japonica Intermediate  241 75.90% 23.20% 0.83% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104300143 C -> G LOC_Os11g08210.1 synonymous_variant ; p.Leu302Leu; LOW synonymous_codon Average:96.103; most accessible tissue: Zhenshan97 flag leaf, score: 99.652 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1104300143 C G -0.01 -0.01 0.0 0.01 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104300143 NA 1.45E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104300143 NA 4.04E-16 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104300143 NA 5.06E-08 mr1121 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 5.07E-06 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 6.39E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 4.45E-06 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 2.31E-06 NA mr1638 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 8.35E-06 mr1036_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 6.12E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 3.34E-09 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 2.49E-10 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 1.94E-10 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104300143 NA 1.62E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251