Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104256046:

Variant ID: vg1104256046 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4256046
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAACAAAAGAAAATGCAAATATTTAACTTTCTGATGACCTGTAAAAGATAATGCAGATACTTTATTTAAATTTCAGCATATCTGTCCGTTTATTTGTCT[G/A]
TCTATCTGTCTTTACAGAAGTGCTTTTCTGATGAGTGATGGCACGCACAAGAAAATGCAGATATTTTATTTAAATATCTTCATCTATTGATTTATCTATA

Reverse complement sequence

TATAGATAAATCAATAGATGAAGATATTTAAATAAAATATCTGCATTTTCTTGTGCGTGCCATCACTCATCAGAAAAGCACTTCTGTAAAGACAGATAGA[C/T]
AGACAAATAAACGGACAGATATGCTGAAATTTAAATAAAGTATCTGCATTATCTTTTACAGGTCATCAGAAAGTTAAATATTTGCATTTTCTTTTGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.20%	0.20%	15.55%	5.04%	NA
All Indica	2759	69.40%	0.30%	23.05%	7.25%	NA
All Japonica	1512	95.80%	0.00%	2.91%	1.32%	NA
Aus	269	90.70%	0.00%	7.43%	1.86%	NA
Indica I	595	61.70%	0.20%	34.62%	3.53%	NA
Indica II	465	61.30%	0.40%	28.17%	10.11%	NA
Indica III	913	80.60%	0.20%	12.16%	7.01%	NA
Indica Intermediate	786	67.20%	0.30%	23.92%	8.65%	NA
Temperate Japonica	767	99.70%	0.00%	0.13%	0.13%	NA
Tropical Japonica	504	89.50%	0.00%	7.34%	3.17%	NA
Japonica Intermediate	241	96.30%	0.00%	2.49%	1.24%	NA
VI/Aromatic	96	70.80%	1.00%	16.67%	11.46%	NA
Intermediate	90	76.70%	0.00%	21.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104256046	G -> A	LOC_Os11g08100.1	downstream_gene_variant ; 4040.0bp to feature; MODIFIER	silent_mutation	Average:48.218; most accessible tissue: Callus, score: 88.329	N	N	N	N
vg1104256046	G -> A	LOC_Os11g08110.1	downstream_gene_variant ; 99.0bp to feature; MODIFIER	silent_mutation	Average:48.218; most accessible tissue: Callus, score: 88.329	N	N	N	N
vg1104256046	G -> A	LOC_Os11g08110.2	downstream_gene_variant ; 99.0bp to feature; MODIFIER	silent_mutation	Average:48.218; most accessible tissue: Callus, score: 88.329	N	N	N	N
vg1104256046	G -> A	LOC_Os11g08110-LOC_Os11g08120	intergenic_region ; MODIFIER	silent_mutation	Average:48.218; most accessible tissue: Callus, score: 88.329	N	N	N	N
vg1104256046	G -> DEL	N	N	silent_mutation	Average:48.218; most accessible tissue: Callus, score: 88.329	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104256046	2.12E-08	1.24E-10	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046	3.29E-06	3.36E-07	mr1571	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046	NA	4.78E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046	NA	6.94E-06	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046	1.21E-19	1.30E-58	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046	1.90E-10	7.97E-13	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046	2.48E-06	1.13E-08	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046	NA	2.92E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104256046	NA	9.76E-08	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251