Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104204113:

Variant ID: vg1104204113 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4204113
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCAGATGAGGTCGAGGGAATAGTGAAGCTCTGCACGTTATACGCATTGAGGCGTAAGGTGTCAGAAGCAACACTTCGACCTTAGGTTTGAGTTTTGTCG[G/A]
ACTTTACAACCAACGGTTCGACATCAGGTCAGAAGACCGTGCGAACGTCCCCATGGAAGGCGTAAAGTTCCAAACGGTGGTTGTTTAGTGGCGAAGGGTA

Reverse complement sequence

TACCCTTCGCCACTAAACAACCACCGTTTGGAACTTTACGCCTTCCATGGGGACGTTCGCACGGTCTTCTGACCTGATGTCGAACCGTTGGTTGTAAAGT[C/T]
CGACAAAACTCAAACCTAAGGTCGAAGTGTTGCTTCTGACACCTTACGCCTCAATGCGTATAACGTGCAGAGCTTCACTATTCCCTCGACCTCATCTGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.90%	0.20%	7.11%	45.81%	NA
All Indica	2759	17.40%	0.30%	9.13%	73.18%	NA
All Japonica	1512	97.90%	0.00%	0.20%	1.85%	NA
Aus	269	62.10%	0.40%	8.55%	29.00%	NA
Indica I	595	27.90%	0.30%	7.90%	63.87%	NA
Indica II	465	15.90%	0.20%	6.67%	77.20%	NA
Indica III	913	10.20%	0.50%	9.97%	79.30%	NA
Indica Intermediate	786	18.60%	0.10%	10.56%	70.74%	NA
Temperate Japonica	767	99.20%	0.00%	0.00%	0.78%	NA
Tropical Japonica	504	96.00%	0.00%	0.60%	3.37%	NA
Japonica Intermediate	241	97.90%	0.00%	0.00%	2.07%	NA
VI/Aromatic	96	32.30%	0.00%	53.12%	14.58%	NA
Intermediate	90	63.30%	0.00%	7.78%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104204113	G -> A	LOC_Os11g08060.1	downstream_gene_variant ; 3917.0bp to feature; MODIFIER	silent_mutation	Average:10.232; most accessible tissue: Callus, score: 36.159	N	N	N	N
vg1104204113	G -> A	LOC_Os11g08050-LOC_Os11g08060	intergenic_region ; MODIFIER	silent_mutation	Average:10.232; most accessible tissue: Callus, score: 36.159	N	N	N	N
vg1104204113	G -> DEL	N	N	silent_mutation	Average:10.232; most accessible tissue: Callus, score: 36.159	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104204113	3.22E-07	NA	mr1337	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	5.16E-07	5.16E-07	mr1337	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	3.24E-06	3.24E-06	mr1487	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	NA	2.06E-06	mr1526	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	1.03E-06	1.22E-06	mr1549	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	NA	1.29E-06	mr1571	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	8.39E-06	8.39E-06	mr1572	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	8.09E-16	4.47E-48	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	1.93E-10	7.59E-13	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104204113	NA	5.53E-06	mr1772	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251