Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104181171:

Variant ID: vg1104181171 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4181171
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCATCGGTCTCACATTCGGAAAGCGCGAGAGCGAAGTGGTCTCGCACTTTTAGCGTGGGCCGGCCGGCCGACGCCGCCTGACGCACTCGGGCCAGGAAG[C/T]
GGTCTCGCACTTTGAGTGCGCAATAGCGTGTGCAGTATCGCGGTCGGCTCGCGTGAGACCGTAGCGACGGGGGCCGTCTGACGCACGTGGGTCCCGGAGA

Reverse complement sequence

TCTCCGGGACCCACGTGCGTCAGACGGCCCCCGTCGCTACGGTCTCACGCGAGCCGACCGCGATACTGCACACGCTATTGCGCACTCAAAGTGCGAGACC[G/A]
CTTCCTGGCCCGAGTGCGTCAGGCGGCGTCGGCCGGCCGGCCCACGCTAAAAGTGCGAGACCACTTCGCTCTCGCGCTTTCCGAATGTGAGACCGATGCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.20%	7.30%	2.16%	57.36%	NA
All Indica	2759	13.60%	0.40%	3.08%	82.93%	NA
All Japonica	1512	66.10%	21.40%	0.26%	12.17%	NA
Aus	269	58.70%	0.40%	3.35%	37.55%	NA
Indica I	595	23.00%	0.00%	2.35%	74.62%	NA
Indica II	465	10.10%	0.20%	3.66%	86.02%	NA
Indica III	913	9.50%	0.20%	2.30%	87.95%	NA
Indica Intermediate	786	13.20%	1.00%	4.20%	81.55%	NA
Temperate Japonica	767	96.60%	2.30%	0.00%	1.04%	NA
Tropical Japonica	504	15.70%	53.20%	0.79%	30.36%	NA
Japonica Intermediate	241	74.70%	15.80%	0.00%	9.54%	NA
VI/Aromatic	96	8.30%	0.00%	1.04%	90.62%	NA
Intermediate	90	30.00%	10.00%	3.33%	56.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104181171	C -> T	LOC_Os11g08040.1	downstream_gene_variant ; 1438.0bp to feature; MODIFIER	silent_mutation	Average:8.873; most accessible tissue: Callus, score: 32.206	N	N	N	N
vg1104181171	C -> T	LOC_Os11g08050.1	downstream_gene_variant ; 3021.0bp to feature; MODIFIER	silent_mutation	Average:8.873; most accessible tissue: Callus, score: 32.206	N	N	N	N
vg1104181171	C -> T	LOC_Os11g08020-LOC_Os11g08040	intergenic_region ; MODIFIER	silent_mutation	Average:8.873; most accessible tissue: Callus, score: 32.206	N	N	N	N
vg1104181171	C -> DEL	N	N	silent_mutation	Average:8.873; most accessible tissue: Callus, score: 32.206	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104181171	NA	1.74E-06	mr1179	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	NA	2.64E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	NA	6.05E-07	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	NA	3.43E-06	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	6.61E-08	5.73E-12	mr1539	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	NA	2.20E-06	mr1826	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	7.97E-08	NA	mr1136_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	NA	1.21E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	NA	5.05E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104181171	NA	4.33E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251