Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104177036:

Variant ID: vg1104177036 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4177036
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AATATTTCAAATCCAAATTAAAACTATACATCAAGTAAAATATGTATGAACAAGATGGTTGGTGGAGGCGCCTCCAATCTCATTCCTCCAGAGTAAAATA[T/A]
ATACAGGATGGTTTTATTAGCTGTAAAAATTTCCCTTTGATACCCAAAATAAACTCTCTACACAATCATCCTTCTTATATCAATGAGTTTTATTCTGAAT

Reverse complement sequence

ATTCAGAATAAAACTCATTGATATAAGAAGGATGATTGTGTAGAGAGTTTATTTTGGGTATCAAAGGGAAATTTTTACAGCTAATAAAACCATCCTGTAT[A/T]
TATTTTACTCTGGAGGAATGAGATTGGAGGCGCCTCCACCAACCATCTTGTTCATACATATTTTACTTGATGTATAGTTTTAATTTGGATTTGAAATATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.20%	39.80%	0.61%	0.36%	NA
All Indica	2759	87.70%	11.10%	0.69%	0.51%	NA
All Japonica	1512	11.40%	88.20%	0.26%	0.13%	NA
Aus	269	24.20%	75.10%	0.74%	0.00%	NA
Indica I	595	77.80%	19.30%	1.85%	1.01%	NA
Indica II	465	94.00%	4.50%	1.08%	0.43%	NA
Indica III	913	91.20%	8.70%	0.11%	0.00%	NA
Indica Intermediate	786	87.30%	11.70%	0.25%	0.76%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	29.00%	70.00%	0.79%	0.20%	NA
Japonica Intermediate	241	7.90%	91.70%	0.00%	0.41%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	58.90%	35.60%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104177036	T -> A	LOC_Os11g08020.1	upstream_gene_variant ; 1870.0bp to feature; MODIFIER	silent_mutation	Average:35.588; most accessible tissue: Callus, score: 79.688	N	N	N	N
vg1104177036	T -> A	LOC_Os11g08020-LOC_Os11g08040	intergenic_region ; MODIFIER	silent_mutation	Average:35.588; most accessible tissue: Callus, score: 79.688	N	N	N	N
vg1104177036	T -> DEL	N	N	silent_mutation	Average:35.588; most accessible tissue: Callus, score: 79.688	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104177036	2.12E-08	1.24E-10	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	NA	4.78E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	NA	1.63E-07	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	NA	6.94E-06	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	1.48E-19	1.15E-57	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	3.33E-12	1.06E-14	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	2.48E-06	1.13E-08	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	1.80E-06	4.98E-07	mr1963	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	NA	2.92E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104177036	NA	9.76E-08	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251