Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104164593:

Variant ID: vg1104164593 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4164593
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTCTTAGATTTCTCTAATTTATTAGAGCGCCACGTGGTGGCTTAGGAACGTTTGTAGAAGCCATGTGGCGGTTTAAGAGTGTTTCTAGGAAGTTTAAT[G/A]
AACTTTTAGTATATACCAGATAGATATTTACAAAATATATTATGTAAATATACATAGAGGGTAACAGGTGCAAAATACTACTTCCGTCCTAGAATATAAG

Reverse complement sequence

CTTATATTCTAGGACGGAAGTAGTATTTTGCACCTGTTACCCTCTATGTATATTTACATAATATATTTTGTAAATATCTATCTGGTATATACTAAAAGTT[C/T]
ATTAAACTTCCTAGAAACACTCTTAAACCGCCACATGGCTTCTACAAACGTTCCTAAGCCACCACGTGGCGCTCTAATAAATTAGAGAAATCTAAGAAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	49.60%	0.38%	0.00%	NA
All Indica	2759	28.20%	71.40%	0.40%	0.00%	NA
All Japonica	1512	88.40%	11.40%	0.20%	0.00%	NA
Aus	269	75.50%	24.50%	0.00%	0.00%	NA
Indica I	595	33.90%	65.00%	1.01%	0.00%	NA
Indica II	465	8.00%	92.00%	0.00%	0.00%	NA
Indica III	913	38.40%	61.40%	0.11%	0.00%	NA
Indica Intermediate	786	23.90%	75.60%	0.51%	0.00%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	70.20%	29.40%	0.40%	0.00%	NA
Japonica Intermediate	241	92.10%	7.50%	0.41%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	37.80%	57.80%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104164593	G -> A	LOC_Os11g08000.1	upstream_gene_variant ; 3372.0bp to feature; MODIFIER	silent_mutation	Average:30.825; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1104164593	G -> A	LOC_Os11g08020.1	downstream_gene_variant ; 3593.0bp to feature; MODIFIER	silent_mutation	Average:30.825; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N
vg1104164593	G -> A	LOC_Os11g08000-LOC_Os11g08020	intergenic_region ; MODIFIER	silent_mutation	Average:30.825; most accessible tissue: Zhenshan97 panicle, score: 43.098	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104164593	7.50E-08	4.21E-10	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104164593	NA	7.11E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104164593	NA	6.79E-06	mr1602	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104164593	NA	7.24E-07	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104164593	2.62E-14	4.90E-45	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104164593	7.70E-07	2.33E-07	mr1638	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104164593	6.74E-08	1.68E-10	mr1638	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104164593	NA	7.00E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104164593	NA	1.80E-07	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251