Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103723794:

Variant ID: vg1103723794 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3723794
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATCTCTGACGGGTTGTAACTTACGACCCGTCACTGATGACAAAGTAAGAAATATAATTTTTGAATTTTAAACGCAACAAAAAACCTCAAAAAAATATTT[T/C]
GAATTTTACTAGCAATCCTATACATGGTTACACATCACTACCTACAAATTCACAATTTTTCACGCAATATAACTTGTATGCTACAAGTGAGATTCGAACT

Reverse complement sequence

AGTTCGAATCTCACTTGTAGCATACAAGTTATATTGCGTGAAAAATTGTGAATTTGTAGGTAGTGATGTGTAACCATGTATAGGATTGCTAGTAAAATTC[A/G]
AAATATTTTTTTGAGGTTTTTTGTTGCGTTTAAAATTCAAAAATTATATTTCTTACTTTGTCATCAGTGACGGGTCGTAAGTTACAACCCGTCAGAGATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.50%	1.60%	4.87%	50.08%	NA
All Indica	2759	31.00%	1.60%	6.09%	61.29%	NA
All Japonica	1512	73.60%	1.90%	2.91%	21.63%	NA
Aus	269	11.20%	0.00%	3.72%	85.13%	NA
Indica I	595	9.40%	1.20%	11.76%	77.65%	NA
Indica II	465	63.00%	2.80%	1.72%	32.47%	NA
Indica III	913	24.30%	0.80%	7.12%	67.80%	NA
Indica Intermediate	786	36.10%	2.30%	3.18%	58.40%	NA
Temperate Japonica	767	96.60%	0.00%	1.96%	1.43%	NA
Tropical Japonica	504	41.50%	5.20%	2.78%	50.60%	NA
Japonica Intermediate	241	67.60%	0.80%	6.22%	25.31%	NA
VI/Aromatic	96	5.20%	0.00%	5.21%	89.58%	NA
Intermediate	90	56.70%	2.20%	3.33%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103723794	T -> DEL	N	N	silent_mutation	Average:6.834; most accessible tissue: Callus, score: 20.379	N	N	N	N
vg1103723794	T -> C	LOC_Os11g07390.1	upstream_gene_variant ; 4356.0bp to feature; MODIFIER	silent_mutation	Average:6.834; most accessible tissue: Callus, score: 20.379	N	N	N	N
vg1103723794	T -> C	LOC_Os11g07400.1	upstream_gene_variant ; 191.0bp to feature; MODIFIER	silent_mutation	Average:6.834; most accessible tissue: Callus, score: 20.379	N	N	N	N
vg1103723794	T -> C	LOC_Os11g07400-LOC_Os11g07410	intergenic_region ; MODIFIER	silent_mutation	Average:6.834; most accessible tissue: Callus, score: 20.379	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103723794	2.38E-06	NA	mr1499_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251