Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103560667:

Variant ID: vg1103560667 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3560667
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

AGACGTATCAGCTACGCCGCGCTGAACCAATAGCCCAAAAACTGAATCGTTTTCCCTGCCTCTGACCTACTCTCTCCGTTAAAAAAAAAATCTAGAATAG[G/A]
TGTAACATATTATAGAACAACGAATTTGAACAGATGTATAGCTGTGTTTAGTTCAGCGCAAAGTTTGGATTTTGGTTGAAATTGGAGATGATGTGACTGA

Reverse complement sequence

TCAGTCACATCATCTCCAATTTCAACCAAAATCCAAACTTTGCGCTGAACTAAACACAGCTATACATCTGTTCAAATTCGTTGTTCTATAATATGTTACA[C/T]
CTATTCTAGATTTTTTTTTTAACGGAGAGAGTAGGTCAGAGGCAGGGAAAACGATTCAGTTTTTGGGCTATTGGTTCAGCGCGGCGTAGCTGATACGTCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	11.30%	0.13%	2.52%	NA
All Indica	2759	81.20%	16.70%	0.07%	2.03%	NA
All Japonica	1512	96.20%	3.80%	0.00%	0.00%	NA
Aus	269	74.70%	0.70%	1.49%	23.05%	NA
Indica I	595	96.00%	0.20%	0.00%	3.87%	NA
Indica II	465	40.40%	59.40%	0.00%	0.22%	NA
Indica III	913	93.80%	4.50%	0.00%	1.75%	NA
Indica Intermediate	786	79.60%	18.10%	0.25%	2.04%	NA
Temperate Japonica	767	99.10%	0.90%	0.00%	0.00%	NA
Tropical Japonica	504	90.10%	9.90%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103560667	G -> A	LOC_Os11g07140.1	downstream_gene_variant ; 2794.0bp to feature; MODIFIER	silent_mutation	Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9	N	N	N	N
vg1103560667	G -> A	LOC_Os11g07150.1	downstream_gene_variant ; 2930.0bp to feature; MODIFIER	silent_mutation	Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9	N	N	N	N
vg1103560667	G -> A	LOC_Os11g07140-LOC_Os11g07150	intergenic_region ; MODIFIER	silent_mutation	Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9	N	N	N	N
vg1103560667	G -> DEL	N	N	silent_mutation	Average:54.478; most accessible tissue: Minghui63 flower, score: 65.9	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103560667	NA	1.44E-12	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1103560667	NA	6.48E-09	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	1.46E-10	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	1.72E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	7.53E-07	mr1944	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	7.89E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	4.31E-07	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	6.50E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	1.28E-07	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	1.95E-06	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	8.20E-06	mr1497_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	5.30E-09	mr1557_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	7.76E-11	mr1565_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	9.37E-10	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	NA	3.40E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103560667	3.61E-06	3.61E-06	mr1848_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251