Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1103462067:

Variant ID: vg1103462067 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 3462067
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCCAGTTGGAGCTGTCTCAAAAAGGTTGGTTTCGTCGCTACCGTCAAGGATGCCTGTGGAGTGGAGTCGCCCCGCTGCAGAAGTCAAGTTTCCAAGTTT[A/T]
GCTCGTTTTATCTTTTCCGCTGCATTTGTAATCTTTTACTTTTTTGTAAGACGTGGACTGTATGTCAACAATTGTCGTTTGTGTACCCTGGCTGGTCCTG

Reverse complement sequence

CAGGACCAGCCAGGGTACACAAACGACAATTGTTGACATACAGTCCACGTCTTACAAAAAAGTAAAAGATTACAAATGCAGCGGAAAAGATAAAACGAGC[T/A]
AAACTTGGAAACTTGACTTCTGCAGCGGGGCGACTCCACTCCACAGGCATCCTTGACGGTAGCGACGAAACCAACCTTTTTGAGACAGCTCCAACTGGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.90%	4.10%	4.78%	20.21%	NA
All Indica	2759	56.90%	6.90%	7.72%	28.42%	NA
All Japonica	1512	90.90%	0.00%	0.40%	8.66%	NA
Aus	269	95.50%	0.00%	0.74%	3.72%	NA
Indica I	595	39.00%	5.70%	7.39%	47.90%	NA
Indica II	465	54.80%	9.50%	7.96%	27.74%	NA
Indica III	913	67.10%	6.20%	8.65%	17.96%	NA
Indica Intermediate	786	59.90%	7.10%	6.74%	26.21%	NA
Temperate Japonica	767	98.40%	0.00%	0.13%	1.43%	NA
Tropical Japonica	504	77.20%	0.00%	0.99%	21.83%	NA
Japonica Intermediate	241	95.90%	0.00%	0.00%	4.15%	NA
VI/Aromatic	96	80.20%	0.00%	3.12%	16.67%	NA
Intermediate	90	78.90%	3.30%	2.22%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1103462067	A -> T	LOC_Os11g06960.1	upstream_gene_variant ; 4964.0bp to feature; MODIFIER	silent_mutation	Average:9.918; most accessible tissue: Zhenshan97 flag leaf, score: 14.027	N	N	N	N
vg1103462067	A -> T	LOC_Os11g06970.1	upstream_gene_variant ; 2782.0bp to feature; MODIFIER	silent_mutation	Average:9.918; most accessible tissue: Zhenshan97 flag leaf, score: 14.027	N	N	N	N
vg1103462067	A -> T	LOC_Os11g06980.1	downstream_gene_variant ; 1832.0bp to feature; MODIFIER	silent_mutation	Average:9.918; most accessible tissue: Zhenshan97 flag leaf, score: 14.027	N	N	N	N
vg1103462067	A -> T	LOC_Os11g06980.2	downstream_gene_variant ; 1832.0bp to feature; MODIFIER	silent_mutation	Average:9.918; most accessible tissue: Zhenshan97 flag leaf, score: 14.027	N	N	N	N
vg1103462067	A -> T	LOC_Os11g06970-LOC_Os11g06980	intergenic_region ; MODIFIER	silent_mutation	Average:9.918; most accessible tissue: Zhenshan97 flag leaf, score: 14.027	N	N	N	N
vg1103462067	A -> DEL	N	N	silent_mutation	Average:9.918; most accessible tissue: Zhenshan97 flag leaf, score: 14.027	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1103462067	1.98E-06	NA	mr1051	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	1.04E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	2.02E-08	mr1439	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	5.62E-06	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	2.14E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	1.92E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	1.96E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	9.36E-06	mr1757	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	2.02E-06	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1103462067	NA	8.26E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251