Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1102086445:

Variant ID: vg1102086445 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 2086445
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

TAGACACTAGCAAAAAAATGGCATGATCAAAGGAGGACTTGATGGTACTCAAGCTATTTGAAAAACTAAAAAGCTCTCTTGTCAGTACTAATTGTTTACT[G/T]
AATTAGGTAAGTACAGCTTACAGAAAAATCATGCTTAGTTAACTTCAGTTTGAATTGGCAAACAAAACTAATACTACCCCCACACAAATGAATCACACCT

Reverse complement sequence

AGGTGTGATTCATTTGTGTGGGGGTAGTATTAGTTTTGTTTGCCAATTCAAACTGAAGTTAACTAAGCATGATTTTTCTGTAAGCTGTACTTACCTAATT[C/A]
AGTAAACAATTAGTACTGACAAGAGAGCTTTTTAGTTTTTCAAATAGCTTGAGTACCATCAAGTCCTCCTTTGATCATGCCATTTTTTTGCTAGTGTCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.60%	11.40%	3.87%	25.03%	NA
All Indica	2759	35.10%	18.50%	6.20%	40.20%	NA
All Japonica	1512	98.30%	0.40%	0.00%	1.26%	NA
Aus	269	74.00%	7.10%	2.23%	16.73%	NA
Indica I	595	84.90%	1.80%	3.70%	9.58%	NA
Indica II	465	12.30%	14.00%	12.04%	61.72%	NA
Indica III	913	13.90%	29.60%	4.49%	52.03%	NA
Indica Intermediate	786	35.50%	21.00%	6.62%	36.90%	NA
Temperate Japonica	767	98.40%	0.30%	0.00%	1.30%	NA
Tropical Japonica	504	97.80%	0.80%	0.00%	1.39%	NA
Japonica Intermediate	241	99.20%	0.00%	0.00%	0.83%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	78.90%	5.60%	5.56%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1102086445	G -> T	LOC_Os11g04894.1	downstream_gene_variant ; 652.0bp to feature; MODIFIER	silent_mutation	Average:28.595; most accessible tissue: Callus, score: 68.466	N	N	N	N
vg1102086445	G -> T	LOC_Os11g04900.1	downstream_gene_variant ; 1352.0bp to feature; MODIFIER	silent_mutation	Average:28.595; most accessible tissue: Callus, score: 68.466	N	N	N	N
vg1102086445	G -> T	LOC_Os11g04910.1	downstream_gene_variant ; 4579.0bp to feature; MODIFIER	silent_mutation	Average:28.595; most accessible tissue: Callus, score: 68.466	N	N	N	N
vg1102086445	G -> T	LOC_Os11g04890-LOC_Os11g04894	intergenic_region ; MODIFIER	silent_mutation	Average:28.595; most accessible tissue: Callus, score: 68.466	N	N	N	N
vg1102086445	G -> DEL	N	N	silent_mutation	Average:28.595; most accessible tissue: Callus, score: 68.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1102086445	NA	5.21E-07	mr1533	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445	1.26E-06	1.26E-06	mr1540	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445	NA	4.99E-06	mr1732	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445	NA	1.05E-07	mr1980	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445	NA	4.72E-08	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1102086445	NA	1.99E-06	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251