Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101299110:

Variant ID: vg1101299110 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1299110
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

AATTAATTGTCACTTACCTTTCATATGCTGGGAACAGATTTTTGCAGCAGTTAGTACTTTCTTGGTGGTTATCATCTGCTTAGTACACTGTTGTTCTCTT[C/T]
TTCTGACTTCTGAGCTGCCGTAGCACAAATTTACTTGATGGCTTTCATTTTACTAAAAGAAAAAATTAAGGTGTAGGTGCGGTTATTATAGTATGTTATT

Reverse complement sequence

AATAACATACTATAATAACCGCACCTACACCTTAATTTTTTCTTTTAGTAAAATGAAAGCCATCAAGTAAATTTGTGCTACGGCAGCTCAGAAGTCAGAA[G/A]
AAGAGAACAACAGTGTACTAAGCAGATGATAACCACCAAGAAAGTACTAACTGCTGCAAAAATCTGTTCCCAGCATATGAAAGGTAAGTGACAATTAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.70%	33.80%	4.74%	10.71%	NA
All Indica	2759	75.20%	1.80%	6.63%	16.31%	NA
All Japonica	1512	3.60%	96.40%	0.00%	0.07%	NA
Aus	269	56.10%	9.70%	14.13%	20.07%	NA
Indica I	595	71.60%	2.90%	10.25%	15.29%	NA
Indica II	465	90.80%	1.50%	3.87%	3.87%	NA
Indica III	913	69.30%	0.70%	5.48%	24.53%	NA
Indica Intermediate	786	75.70%	2.50%	6.87%	14.89%	NA
Temperate Japonica	767	2.90%	97.00%	0.00%	0.13%	NA
Tropical Japonica	504	4.00%	96.00%	0.00%	0.00%	NA
Japonica Intermediate	241	5.00%	95.00%	0.00%	0.00%	NA
VI/Aromatic	96	71.90%	28.10%	0.00%	0.00%	NA
Intermediate	90	53.30%	42.20%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101299110	C -> T	LOC_Os11g03420.1	downstream_gene_variant ; 117.0bp to feature; MODIFIER	silent_mutation	Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg1101299110	C -> T	LOC_Os11g03420-LOC_Os11g03430	intergenic_region ; MODIFIER	silent_mutation	Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N
vg1101299110	C -> DEL	N	N	silent_mutation	Average:42.521; most accessible tissue: Zhenshan97 flower, score: 73.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101299110	1.92E-06	NA	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110	2.64E-08	2.64E-09	mr1038	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110	2.42E-08	NA	mr1389	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110	1.13E-10	2.83E-11	mr1389	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110	1.33E-08	NA	mr1038_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110	1.78E-11	1.81E-11	mr1038_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110	2.05E-06	NA	mr1141_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110	4.00E-07	1.40E-06	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101299110	1.70E-09	1.57E-09	mr1389_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251